Citation: Díaz-Formoso, L.; Contente, D.; Feito, J.; Hernández, P.E.; Borrero, J.; Muñoz-Atienza, E.; Cintas, L.M. Genomic Sequence of Streptococcus salivarius MDI13 and Latilactobacillus sakei MEI5: Two Promising Probiotic Strains Isolated from European Hakes (Merluccius merluccius, L.). Vet. Sci. 2024, 11, 365. https://doi.org/ 10.3390/vetsci11080365 Academic Editor: Alessandra Pelagalli Received: 22 July 2024 Revised: 4 August 2024 Accepted: 7 August 2024 Published: 10 August 2024 Copyright: © 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https:// creativecommons.org/licenses/by/ 4.0/). veterinary sciences Article Genomic Sequence of Streptococcus salivarius MDI13 and Latilactobacillus sakei MEI5: Two Promising Probiotic Strains Isolated from European Hakes (Merluccius merluccius, L.) Lara Díaz-Formoso, Diogo Contente, Javier Feito * , Pablo E. Hernández , Juan Borrero , Estefanía Muñoz-Atienza * and Luis M. Cintas Grupo de Seguridad y Calidad de los Alimentos por Bacterias Lácticas, Bacteriocinas y Probióticos (Grupo SEGABALBP), Sección Departamental de Nutrición y Ciencia de los Alimentos (Nutrición, Bromatología, Higiene y Seguridad Alimentaria), Facultad de Veterinaria, Universidad Complutense de Madrid, Avda. Puerta de Hierro, s/n, 28040 Madrid, Spain; lardia01@ucm.es (L.D.-F.); diogodas@ucm.es (D.C.); ehernan@ucm.es (P.E.H.); jborrero@ucm.es (J.B.); lcintas@ucm.es (L.M.C.) * Correspondence: j.feito@ucm.es (J.F.); ematienza@vet.ucm.es (E.M.-A.) Simple Summary: In fish farming, diseases have commonly been fought with the abusive use of antibiotics, which have caused antibiotic (multi)resistances in bacteria. Consequently, it is necessary to explore safe and environmentally friendly alternative approaches to improve the fish health and avoid the treatment of bacterial diseases with antibiotics such as the use of probiotics. This study focuses on bioinformatic and functional analyses of the genome sequences of Streptococcus salivarius MDI13 and Latilactobacillus sakei MEI5, two Lactic Acid Bacteria (LAB) isolated from the gut of European hakes (Merluccius merluccius, L.), a highly valued marine fish for Spanish gastronomy. The potential probiotic characteristics of both bacteria, and the lack of antibiotic resistance genes and virulence were confirmed. In addition, genes encoding three antimicrobial peptides (known as bacteriocins) were identified in the genome of S. salivarius MDI13. One of these in vitro-synthesized bacteriocins (BlpK) showed antimicrobial activity against two fish pathogens (namely Lactococcus garvieae and Streptococcus parauberis). Altogether, our results suggest that S. salivarius MDI13 and L. sakei MEI5 have a strong potential as probiotics to prevent bacterial diseases in fish farming. Abstract: Frequently, diseases in aquaculture have been fought indiscriminately with the use of antibiotics, which has led to the development and dissemination of (multiple) antibiotic resistances in bacteria. Consequently, it is necessary to look for alternative and complementary approaches to chemotheraphy that are safe for humans, animals, and the environment, such as the use of probiotics in fish farming. The objective of this work was the Whole-Genome Sequencing (WGS) and bioinfor- matic and functional analyses of S. salivarius MDI13 and L. sakei MEI5, two LAB strains isolated from the gut of commercial European hakes (M. merluccius, L.) caught in the Northeast Atlantic Ocean. The WGS and bioinformatic and functional analyses confirmed the lack of transferable antibiotic resistance genes, the lack of virulence and pathogenicity issues, and their potentially probiotic characteristics. Specifically, genes involved in adhesion and aggregation, vitamin biosynthesis, and amino acid metabolism were detected in both strains. In addition, genes related to lactic acid production, active metabolism, and/or adaptation to stress and adverse conditions in the host gastrointestinal tract were detected in L. sakei MEI5. Moreover, a gene cluster encoding three bacteriocins (SlvV, BlpK, and BlpE) was identified in the genome of S. salivarius MDI13. The in vitro-synthesized bacteriocin BlpK showed antimicrobial activity against the ichthyopathogens Lc. garvieae and S. parauberis. Altogether, our results suggest that S. salivarius MDI13 and L. sakei MEI5 have a strong potential as probiotics to prevent fish diseases in aquaculture as an appropriate alternative/complementary strategy to the use of antibiotics. Vet. Sci. 2024, 11, 365. https://doi.org/10.3390/vetsci11080365 https://www.mdpi.com/journal/vetsci https://doi.org/10.3390/vetsci11080365 https://doi.org/10.3390/vetsci11080365 https://creativecommons.org/ https://creativecommons.org/licenses/by/4.0/ https://creativecommons.org/licenses/by/4.0/ https://www.mdpi.com/journal/vetsci https://www.mdpi.com https://orcid.org/0000-0003-1774-3372 https://orcid.org/0000-0001-6259-8456 https://orcid.org/0000-0002-9203-0551 https://orcid.org/0000-0001-6218-1511 https://orcid.org/0000-0003-4161-0385 https://doi.org/10.3390/vetsci11080365 https://www.mdpi.com/journal/vetsci https://www.mdpi.com/article/10.3390/vetsci11080365?type=check_update&version=1 Vet. Sci. 2024, 11, 365 2 of 21 Keywords: marine fish; probiotics; lactic acid bacteria (LAB); whole-genome sequencing (WGS); antimicrobial peptides 1. Introduction Aquaculture is defined by the Food and Agriculture Organization of the United Nations (FAO) as the farming of aquatic animals, including fish, crustaceans, mollusks, and aquatic plants. In 2022, global aquatic animal production was approximately 223.2 million tons, reaching a historic record. Compared to 2020, aquaculture increased by 6.6%. Of the total production of aquatic animals, 89% was intended for human consumption, making them one of the most traded food products globally. Today, the challenge of feeding a growing population without depleting natural resources continues to grow. In this sense, aquatic food systems have great potential to meet the nutritious food needs of humanity [1]. One of the main issues in fish farming is the fish stress, which can be minimized by using the appropriate husbandry methods. However, stress can never be completely eliminated, which increases the susceptibility to disease occurrence and leads to massive mortalities. Bacteria are the primary pathogens affecting marine species, accounting for 54.9% of all infections [2]. Common pathogenic bacteria responsible of severe infections in numerous economically valuable fish species include Vibrio spp. (e.g., Vibrio harveyi, Vibrio vulnificus, Vibrio parahaemolyticus, and Vibrio alginolyticus), Listonella anguillarum, Tenacibacullum maritimum, Aeromonas salmonicida, Streptococcus parauberis, and Lactococcus garvieae, amongst others. For example, diseases such as tenacibaculosis (caused by T. maritimum), which affects many marine fish such as turbot and sea bass, can have very high mortality rates. There is also vibriosis, which can cause the death of 50% of infected fish and shellfish. In addition, Aeromonas infections, such as A. salmonicida, are quite common and can be lethal, especially in cold-water salmonids. Regarding Gram-positive bacteria, S. parauberis is the main bacterial agent that causes a significant economic loss to the mariculture industry, and Lc. garvieae is a common agent that can provoke significant economic losses not only in several fresh fish species but also in saltwater species [2,3]. Traditionally, diseases in aquaculture have been fought with the indiscriminate use of antibiotics, which has led to the development and spread of (multiple) antibiotic resistances in bacteria. For this reason, it is necessary to search for new alternative/complementary strategies safe for humans, animals, and the environment, such as the use of probiotics in fish farming [4,5]. Probiotics are defined by the World Health Organization (WHO) and FAO as live microorganisms that, when supplied in sufficient quantity, enhance the health of the host [6]. In a broader definition, probiotics for aquaculture are considered as live microbial cultures that exert a beneficial effect on the host by (i) modifying its microbiota and/or that of its environment; (ii) enhancing the efficiency of feed assimilation and/or its nutritional value; (iii) improving the host response to disease; and/or (iv) increasing the quality of the aquatic environment in which the host grows [7–9]. Currently, only one microorganism is internationally authorized for use as a zootech- nical additive in the aquaculture of all fish and crustacean species in the European Union (EU), namely Pediococcus acidilactici CNCM I-42622 (formerly MA18/5M), a strain regis- tered under the trade name Bactocell® [10]. Microorganisms proposed as probiotics in fish farming must display antimicrobial activity and must be considered safe not only for aquatic animals, but also for the surrounding environment and humans [11]. Most of the studies conducted in the field of probiotics for aquaculture focus on Lactic Acid Bacteria (LAB), awarded the Generally Recognized As Safe (GRAS) status by the Food and Drug Administration (FDA) and included in the Qualified Presumption of Safety (QPS) list established by the European Food Safety Authority (EFSA) due to their universal presence in food and their contribution to the healthy microbiota of the human gut [12–16]. LAB are the most studied group of microorganisms as probiotics for aquaculture and there are many Vet. Sci. 2024, 11, 365 3 of 21 studies evaluating their application in fish production. The main mechanisms by which probiotics can exert benefits in aquaculture include the following: (i) the modulation of the host microbiota and/or its environment; (ii) the improvement of feed utilization and/or its nutritional value; (iii) the reduction of host susceptibility to diseases; (iv) the improvement of host response to stress; (v) the enhancement of reprouctive function; and/or (vi) the improvement of water characteristics [9,17–21]. In general, in the process of the selection and evaluation of probiotic strains, their full and comprehensive characterization is essential to demonstrate their safety and beneficial effects on the host health. Recently, the EFSA has included Whole-Genome Sequencing (WGS) as a requisite for the characterization of bacteria and yeasts proposed as products or as enzyme-producing strains in food and feed [22]. Therefore, the study of the complete genome of probiotic strains, using Next-Generation Sequencing (NGS) techniques, has great relevance in the detection of genes responsible for their probiotic characteristics (e.g., production of antimicrobial compounds) and in the evaluation of their safety by studying the presence of antibiotic resistance and other virulence factor genes [23]. Among the desirable antimicrobial compounds for probiotic strains are bacteriocins, which are defined as ribosomally synthesized peptides produced and secreted by Gram-positive and Gram-negative bacteria that have a variable antimicrobial spectrum against bacterial pathogens [23]. Therefore, the overall objective of this work was the WGS, bioinformatic, and func- tional analyses and safety characterization of two strains (S. salivarius MDI13 and L. sakei MEI5) isolated from the gut of European hakes (Merluccius merluccius, L.) from the North- east Atlantic Ocean for their potential application as probiotics in aquaculture. 2. Materials and Methods 2.1. Growth Conditions and Isolation of Genomic DNA S. salivarius MDI13 and L. sakei MEI5 were isolated from non-eviscerated commercial European hakes (Merluccius merluccius, L.) caught from the Northeast Atlantic Ocean (Southwest of Ireland), provided by a Galician skipper dedicated to professional fishing. Both strains were grown in Man, Rogosa and Sharpe (MRS) agar (1.5%, w/v) plates (Oxoid, Basingstoke, UK) at 30 ◦C overnight. The genomic DNA of the two strains was first extracted and purified using the DNeasy Blood & Tissue kit (Qiagen, Hilden, Alemania) following the manufacturer’s instruction, and then quantified (ng/µL) in a Qubit 4 fluorometer (Invitrogen, Waltham, MA, USA). 2.2. Whole-Genome Sequencing (WGS), Assembly, and Mapping The WGS of both strains was carried out at the SeqCenter (Pittsburgh, PA, USA). In brief, the Illumina DNA Prep kit and 10 bp unique dual index (UDI) from Integrated DNA Technologies (IDT) were used to prepare libraries. Afterward, they were sequenced on an Illumina NextSeq 2000 (Illumina, San Diego, CA, USA), producing 2 × 150 bp reads. The BCL Convert software v3.9.3 (Illumina) was used to perform the demultiplexing, quality control, and adapter trimming. The Unicycler v0.4.8 program was used to assemble the resulting sequence reads into contigs [24]. Rounds of assembly polishing were conducted with the Pilon program (Oxford Nanopore Technologies, Oxford, UK). Assembly anno- tation was performed with the Rapid Annotations using Subsystems Technology (RAST) server [25]. In addition, genome mapping of the two strains was created by the Proksee web server (https://proksee.ca/ accessed on 6 August 2024) [26]. 2.3. Bioinformatic (In Silico) Analyses 2.3.1. Identification of Bacterial Species Although the two probiotic candidates were formerly identified by DNA sequenc- ing of the gene that encodes the 16S rRNA subunit (16S rDNA) as S. salivarius and L. sakei, their identification was validated by two different databases. Specifically, Species- Finder v.2.0., which identifies bacteria according to the complete sequence of the 16S https://proksee.ca/ Vet. Sci. 2024, 11, 365 4 of 21 rDNA, and KmerFinder v.3.0.2., which relies on the frequency of overlapping kmers (i.e., 16-mers) [27,28]. 2.3.2. Assembly Evaluation, Bacteriocin Identification, and Safety Evaluation The assembled genomic sequences of the two strains were analyzed individually to confirm their taxonomic identification at the species level and to (i) evaluate the quality of the assembly; (ii) identify the genes and operons related to the biosynthesis and production of bacteriocins; and (iii) to evaluate their safety by identifying genes encoding potential virulence factors and antibiotic resistance genes by means of several web server programs (Table 1). The RAST platform was used to obtain general data for the two genomes analyzed and to assess the quality of the assembly by evaluating the L50 and N50 values. The identification of Clustered Regularly Interspaced Short Palindromic Repeats (CRISPRs) and CRISPR-associated proteins (cas) (CRISPR-Cas) systems, and mobile genetic elements, for instance active prophages, insertion sequences (ISs), and plasmids, was carried out using several bioinformatics pipelines (Table 1). Additionally, a phylogenetic WGS-based mapping and the genomic maps of the two strains were created by the Type (Strain) Genome Server (TYGS) and the Proksee web server, respectively (Table 1). Table 1. Bioinformatic tools used for genome analyses of S. salivarius MDI13 and L. sakei MEI5. Analysis Type Web Server Program Website Accessed on Reference Bacterial identification SpeciesFinder v.2.0 KmerFinder v.3.0.2 https://cge.cbs.dtu.dk/services/SpeciesFinder/ https://cge.cbs.dtu.dk/services/KmerFinder/ 1 June 2023 Larsen et al. (2014) [27] Hasman et al. (2014) [28] Genome annotation Rapid Annotations using Subsystems Technology (RAST) https://rast.nmpdr.org/rast.cgi 8 June 2023 Overbeek et al. (2014) [25] Bacteriocin production Bagel4 http://bagel4.molgenrug.nl/index.php 15 September 2023 Van Heel et al. (2018) [29] Alignment between amino acid sequences BLAST protein https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins 15 September 2023 Singh et al. (2016) [30] Multiple sequence alignment Clustal Omega https://www.ebi.ac.uk/jdispatcher/msa/clustalo 15 September 2023 Sievers et al. (2011) [31] Virulence factors VirulenceFinder v.2.0 http://www.mgc.ac.cn/VFs/main.htm 16 July 2023 Joensen et al. (2014) [32] Antibiotic resistance ResFinder v.4.1 https://cge.cbs.dtu.dk/services/ResFinder/ 16 July 2023 Bortolaia et al. (2020) [33] Pathogenicity PathogenFinder v.1.1 https://cge.cbs.dtu.dk/services/PathogenFinder/ 16 July 2023 Consentino et al. (2013) [34] IS MGE https://cge.cbs.dtu.dk/services/MobileElementFinder/ 3 September 2023 Siguier et al. (2006) [35] Active prophages Prophage Hunter https://pro-hunter.genomics.cn/index.php/Home/hunter/ hunter.html 7 September 2023 Song et al. (2019) [36] Plasmids PlasmidFinder v.2.1 https://cge.cbs.dtu.dk/services/PlasmidFinder/ 7 September 2023 Carattoli et al. (2014) [37] CRISPR-Cas system CRISPRCasFinder https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFinder/Index 9 September 2023 Couvin et al. (2018) [38] Type (Strain) Genome Server TYGS https://tygs.dsmz.de 13 September 2023 Meier et al. (2019) [39] Genomic maps Proksee web server https://www.ebi.ac.uk/Tools/msa/clustalo/ 13 September 2023 Grant et al. (2023) [26] 2.4. Evaluation of the Deconjugation of Bile Salts The capacity of the two strains to deconjugate taurocholate and taurodeoxycholate was evaluated using a protocol described by Noriega et al. (2006) [40]. First, bacteria were inoculated in MRS broth (Oxoid) and incubated at 30 ◦C under aerobic conditions for 16 h. After incubation, 10 µL of the cultures was inoculated onto MRS agar (1.5%, w/v) plates supplemented with L-cysteine (0.05%, w/v, Merck, Darmstadt, Germany) and the respective bile salts (taurocholate or taurodeoxycholate, 0.5%, w/v, Sigma-Aldrich, Darmstadt, Germany), and incubated at 37 ◦C in anaerobiosis (AnaeroGen, Oxoid) for 72 h. A fresh fecal slurry from a healthy adult cow was employed as a positive control. 2.5. Evaluation of the Degradation of Mucin The capacity of the two strains to degrade gastric mucin was evaluated following the method described by Zhou et al. (2001) [41]. Mucin from porcine stomach type III (Sigma-Aldrich) and agar were added into medium B without glucose at concentrations of 0.5 and 1.5% (w/v), respectively. In brief, 10 µL of cultures grown in MRS broth was spotted onto the medium B containing mucin. After the incubation at 37 ◦C for 72 h in anaerobiosis (AnaeroGen, Oxoid), the plates were stained with a 0.1% (w/v) solution of https://cge.cbs.dtu.dk/services/SpeciesFinder/ https://cge.cbs.dtu.dk/services/KmerFinder/ https://rast.nmpdr.org/rast.cgi http://bagel4.molgenrug.nl/index.php https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE=Proteins https://www.ebi.ac.uk/jdispatcher/msa/clustalo http://www.mgc.ac.cn/VFs/main.htm https://cge.cbs.dtu.dk/services/ResFinder/ https://cge.cbs.dtu.dk/services/PathogenFinder/ https://cge.cbs.dtu.dk/services/MobileElementFinder/ https://pro-hunter.genomics.cn/index.php/Home/hunter/hunter.html https://pro-hunter.genomics.cn/index.php/Home/hunter/hunter.html https://cge.cbs.dtu.dk/services/PlasmidFinder/ https://crisprcas.i2bc.paris-saclay.fr/CrisprCasFinder/Index https://tygs.dsmz.de https://www.ebi.ac.uk/Tools/msa/clustalo/ Vet. Sci. 2024, 11, 365 5 of 21 amido black (Merck KGaA) in 3.5 mol/L acetic acid for 30 min and then washed with 1.2 mol/L acetic acid (Merck KGaA). The appearance of a discolored zone around the bacterial spots indicated a positive result. A fresh fecal slurry from a healthy adult cow served as a positive control. 2.6. Evaluation of the Production of Biogenic Amine The presence of hdc, tdc, odc, and ldc, encoding histidine decarboxylase (HDC), tyrosine decarboxylase (TDC), ornithine decarboxylase (ODC), and lysine decarboxylase (LDC), respectively, was evaluated by PCR. PCR amplifications were performed using previously reported primers [42–45] and the PCR products were visualized in an agarose (1,5% w/v) (Pronadisa, Madrid, Spain) gel with GelRed Nucleic Acid Gel Stain (Biotium, Inc., Fre- mont, CA, USA) using a ChemiDoc Imaging System (Bio-Rad Laboratories, Inc., Hercules, CA, USA). 2.7. Synthesis In Vitro of Bacteriocins and Evaluation of Their Antimicrobial Activity Total genomic DNA from S. salivarius MDI13 was used to amplify the nucleotide sequences of the mature bacteriocins of interest (slvV, blpK, and blpE). Oligonucleotides (Table 2) were acquired from Thermo Fisher Scientific (Waltham, MA, USA). The nucleotide sequence of the T7 promoter was included in the forward primers, which was followed by the first 29, 28, and 27 bases corresponding to the genes of interest (slvV, blpK, and blpE, respectively) and starting with ATG. In the case of reverse primers, these contained the nucleotide sequence of the T7 terminator followed by the last 22, 24, and 24 bases of the gene of interest (slvV, blpK, and blpE, respectively). PCR amplifications were performed using the Phusion Hot Start II High-Fidelity DNA Polymerase (Thermo Fisher Scientific) and genomic DNA (5–100 ng). After visualization of PCR-amplified gene fragments as described above, amplicons were purified using the NucleoSpin® Gel and PCR Clean-up kit (Macherey-Nagel™, Allentown, PA, USA), and quantified with a Qubit fluorometer system (Invitrogen, Waltham, MA, USA). To conduct in vitro cell-free protein synthesis (IV-CFPS) reactions, purified PCR amplicons were used as templates using the PURExpress In vitro Protein Synthesis Kit (New England Biolabs, Ipswich, MA, USA) and a final DNA concentration of 10 ng/µL, and then incubated at 37 ◦C for 2 h [46–48]. Table 2. Oligonucleotides used in this work. Oligonucleotide Primers Nucleotide Sequence (5′-3′) a PCR-Amplified Gene Fragment b slvV-F GGGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAG GAAAAAATATGGCATGTAGTTTTTGGGGAGCTACAGCTGC slvV slvV-R AAACCCCTCCGTTTAGAGAGGGGTTATGCTAGTTAATAACGACAAA TAAGTCCATAAG blpK-F GGGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAG GAAAAAATATGGGATGTAGCTGGGGAGGTTTTGCTAAAC blpK blpK-R AAACCCCTCCGTTTAGAGAGGGGTTATGCTAGTTACCACCAGCATGTT GCTCCATAACC blpE-F GGGAATTAATACGACTCACTATAGGGCTTAAGTATAAGGAG GAAAAAATATGCGAGTCAATTGGGAACGATGGGGAATG blpE blpE-R AAACCCCTCCGTTTAGAGAGGGGTTATGCTAGTTA ACAGCCAAGTAAGGCTACTCCACC a T7 promoter is shown in bold; T7 transcription terminator is underlined. b Each PCR-amplified gene fragment contains the mature sequence of the bacteriocin flanked by the T7 promoter and transcription terminator. The antimicrobial activity of the in vitro-synthesized peptides (bacteriocins) was as- sessed using the Spot-On-Agar Test (SOAT) [49]. In brief, 5 µL of samples was placed onto the surface of MRS, TSB, or BHI (Oxoid) agar (1.5%, w/v) plates, overlaid with a soft agar (0.8%, w/v) containing fresh overnight cultures (ca. 105 CFU/mL) of the indi- cators (Lc. garvieae CF00021, Yersinia ruckeri LMG3279, Aeromonas hydrophila CECT839, A. Vet. Sci. 2024, 11, 365 6 of 21 salmonicida CLFP-23, A. salmonicida CECT4237, Ls. anguillarum CECT4344, and S. parauberis LMG22252). The antimicrobial activity of the synthesized bacteriocins SlvV, BlpK, and BlpE was assessed in two ways, individually and in combination. When each bacteriocin was evaluated individually, 5 µL was added. When tested together, the bacteriocins (BlpK-SlvV, BlpK-BlpE, and BlpE-SlvV) were mixed at an equal ratio (1:1). 3. Results 3.1. WGS, Assembly, and Mapping of S. salivarius MDI13 and L. sakei MEI5 The WGS of S. salivarius MDI13 and L. sakei MEI5, two interesting potential probiotic candidates previously isolated from the gut of European hakes caught in the Northeast Atlantic Ocean [50], was determined and analyzed. In this respect, both genomes were found to meet the criteria established by EFSA [22], with contig counts below 500 (29 and 15 contigs in S. salivarius MDI13 and L. sakei MEI5, respectively) (Table 3). Table 3. General characteristics of the assembled genome of the two sequenced LAB strains. Characteristic S. salivarius MDI13 L. sakei MEI5 Size (bp) 2,088,084 1,712,091 Content G + C (%) a 40.0 37.0 L50 b 5 3 N50 c (bp) 195,997 237,072 Contigs (nº) 29 15 Subsystems (nº) 219 197 Coding DNA sequences (nº) 1952 1711 RNA sequences (nº) 39 48 a G + C content: guanine and cytosine content in each genome; b L50: smallest number of contigs whose length is half the size of the genome; c N50: length of the smallest contig of the group that constitutes 50% of the genome. The genome of S. salivarius MDI13 comprises 29 contigs (2,088,084 bp), with 40.0% of G + C content, and N50 and L50 values of 195,997 and 5, respectively. In addition, this genome contains 219 gene subsystems (set of genes that synthesize proteins with similar or associated functions). The total numbers of coding DNA sequences (CDSs) and RNAs were 1,952 and 39, respectively. On the other hand, the genome of L. sakei MEI15 consists of 37 contigs (1,712,091 bp), with 37.0% of G + C content, and N50 and L50 values of 237,072 and 3, respectively. Moreover, this genome contains 197 gene subsystems. The total numbers of CDSs and RNAs were 1,711 and 48, respectively (Table 3). In addition, a genomic map was made in order to visualize features of interest in the bacterial genomes (Figure 1). 3.2. Bioinformatic and Functional Analyses of the Genome of S. salivarius MDI13 and L. sakei MEI5 3.2.1. Species Identification In this work, we proceeded to sequence the genome of S. salivarius MDI13 and L. sakei MEI5. The SpeciesFinder and KmerFinder software programs confirmed their identification as S. salivarius MDI13 and L. sakei MEI5. The TYGS server was used to perform species and subspecies similarity estimations from the closest defined type genome sequences. TYGS phylogenetic tree for the two probiotic candidates showed that S. salivarius MDI13 constitutes a single subcluster (Ib) with respect to subcluster Ia of the species type strains (S. salivarius NCTC8618 and S. salivarius ATCC7073; 67% identity). On the other hand, L. sakei MEI5 is part of a single cluster (VIII) including the species type strains (L. sakei JCM1157 and L. sakei ATCC15521; 100% identity) (Figure 2). Vet. Sci. 2024, 11, 365 7 of 21 Vet. Sci. 2024, 11, x FOR PEER REVIEW  7  of  22        Figure 1. Genome mapping of S. salivarius MDI13 (A) and L. sakei MEI5 (B), generated using the  Proksee webserver. ORFs (Open Reading Frames) and CG skew + and − are indicated in dark blue,  green, and violet, respectively. CRISPR arrays and cas cluster systems are shown in orange and light  pink, respectively.  3.2. Bioinformatic and Functional Analyses of the Genome of S. salivarius MDI13 and L. sakei  MEI5  3.2.1. Species Identification  In  this work, we proceeded  to sequence  the genome of S. salivarius MDI13 and L.  sakei MEI5. The SpeciesFinder and KmerFinder software programs confirmed their identi‐ fication as S. salivarius MDI13 and L. sakei MEI5.  The TYGS server was used to perform species and subspecies similarity estimations  from  the  closest defined  type genome  sequences. TYGS phylogenetic  tree  for  the  two  probiotic candidates showed that S. salivarius MDI13 constitutes a single subcluster (Ib)  with  respect  to subcluster  Ia of  the species  type strains  (S. salivarius NCTC8618 and S.  Figure 1. Genome mapping of S. salivarius MDI13 (A) and L. sakei MEI5 (B), generated using the Proksee webserver. ORFs (Open Reading Frames) and CG skew + and − are indicated in dark blue, green, and violet, respectively. CRISPR arrays and cas cluster systems are shown in orange and light pink, respectively. 3.2.2. Distribution of Functional Genetic Subsystems Using the RAST platform, the sequences of S. salivarius MDI13 and L. sakei MEI5 were analyzed, and 17 functional gene subsystems were identified (Figure 3). S. salivarius MDI13 showed a high number of genes associated with the biosynthesis of amino acids and derivatives (156; 21.7%), followed by protein metabolism (108; 15.0%), carbohydrate metabolism (103; 14.3%), and nucleosides and nucleotides (77; 10.7%). In the L. sakei MEI5 genome, genes related to amino acids and derivatives (133; 20.2%), protein metabolism (111; 16.9%), nucleosides and nucleotides (88; 13.4%), and carbohydrate metabolism (83, 12.6%) were also identified. In both genomes, genes associated with motility and chemotaxis, nitrogen metabolism, and photosynthesis were not found. Vet. Sci. 2024, 11, 365 8 of 21 Vet. Sci. 2024, 11, x FOR PEER REVIEW  8  of  22      salivarius ATCC7073; 67%  identity). On the other hand, L. sakei MEI5  is part of a single  cluster (VIII) including the species type strains (L. sakei JCM1157 and L. sakei ATCC15521;  100% identity) (Figure 2).    Figure 2. Genome-based phylogenetic tree of S. salivarius MDI13 (A) and L. sakei MEI5 (B) created by the TYGS webserver. Blue crosses indicate the probiotic candidates evaluated in this study and red dots point out the species type strains. Vet. Sci. 2024, 11, 365 9 of 21 Vet. Sci. 2024, 11, x FOR PEER REVIEW  9  of  22      Figure 2. Genome‐based phylogenetic tree of S. salivarius MDI13 (A) and L. sakei MEI5 (B) created  by the TYGS webserver. Blue crosses indicate the probiotic candidates evaluated in this study and  red dots point out the species type strains.  3.2.2. Distribution of Functional Genetic Subsystems.  Using  the RAST platform,  the  sequences of S. salivarius MDI13 and L. sakei MEI5  were analyzed, and 17 functional gene subsystems were identified (Figure 3). S. salivarius  MDI13 showed a high number of genes associated with the biosynthesis of amino acids  and derivatives (156; 21.7%), followed by protein metabolism (108; 15.0%), carbohydrate  metabolism (103; 14.3%), and nucleosides and nucleotides (77; 10.7%). In the L. sakei MEI5  genome, genes related to amino acids and derivatives (133; 20.2%), protein metabolism  (111; 16.9%), nucleosides and nucleotides (88; 13.4%), and carbohydrate metabolism (83,  12.6%) were also identified. In both genomes, genes associated with motility and chem‐ otaxis, nitrogen metabolism, and photosynthesis were not found.      Figure 3. Functional gene subsystems identified in the genome of S. salivarius MDI13 (A) and L. sakei MEI5 (B), obtained using the RAST program. 3.2.3. Identification of Genetic Determinants Related to Various Probiotic Traits For the determination of potential probiotic characteristics, RAST annotation of the assembled genome of S. salivarius MDI13 and L. sakei MEI5 was used to identify genes involved in probiotic properties. In the case of the genome of S. salivarius MDI13, genes as- sociated with vitamin biosynthesis, adhesion and aggregation, and amino acid metabolism were identified (Table S1). On the other hand, in the genome of L. sakei MEI5, not only were genes involved in adhesion and aggregation, vitamin biosynthesis, amino acid metabolism detected, but also genes responsible for antimicrobial activity, active metabolism, and stress adaptation/host gastrointestinal tract adaptation (tolerance to temperature, acid, pH, bile salts, osmotic stress, and oxidative stress) (Table S1). The genome analyses of each strain evaluated in this work identified the existence of genes related to adhesion and aggregation. In this regard, S. salivarius MDI13 and L. sakei MEI5 had genes encoding proteins for the capacity to adhere to the host cells Vet. Sci. 2024, 11, 365 10 of 21 through the gastrointestinal tract, including those encoding the fibronectin-binding protein, exopolysaccharide (EPS), triosephosphate isomerase, and sortase A. Moreover, L. sakei MEI5 also had the enolase gene. Regarding vitamin biosynthesis, the RAST software predicted the existence of genes linked to the biosynthesis of vitamins, such as thiamine (B1), riboflavin (B2), pyridoxin (B6), biotin (B7), and folate (B9), in the genome of S. salivarius MDI13 and L. sakei MEI5 (Table S1). The genome analyses also allowed the detection of genes associated with amino acid biosynthesis. Specifically, L. sakei MEI5 encodes genes related to the biosynthesis of tryptophan, leucine, arginine, taurine, methionine, threonine, and lysine, while S. salivarius MDI13 only presented genes related to the biosynthesis of threonine and tryptophan (Table S1). Genes related to the production of lactic acid, such as D-lactate and L-lactate dehydrogenase, were only predicted in the genome of L. sakei MEI5 (Table S1). In addition, genes related to stress adaptation (e.g., tolerance to acid, pH, temperature, bile salts, and osmotic and oxidative stress) were detected in the genome of L. sakei MEI5 but not in S. salivarius MDI13 (Table S1). 3.2.4. Identification of Antibiotic Resistance Genes and Other Virulence Factors Regarding the safety evaluation of the two probiotic candidate LAB strains character- ized in this work, no genes encoding virulence factors were detected using the Virulence- Factor 2.0 database and the PathogenFinder platform. In addition, no resistance genes were detected in any of the two probiotic candidates using the ResFinder 4.1 database. 3.2.5. Identification of Mobile Genetic Elements (MGEs) and CRISPR-Cas Systems In the identification of MGEs, the possible existence of ISs was analyzed through the ISfinder program. ISs are DNA sequences that can move or integrate into the bacterial genome. The results revealed the presence of 7 and 11 true ISs in S. salivarius MDI13 and L. sakei MEI5 genomes, respectively (Table 4), which means that each ORF was identified as a transposase and the detected ISs displayed an e-value of 0.0 [51]. Table 4. Mobile genetic elements (ISs, active prophages, and plasmids) and CRISPR-Cas systems identified in the genome of S. salivarius MDI13 and L. sakei MEI5. Analyzed MGE S. salivarius MDI13 L. sakei MEI5 Insertion sequences (ISs) IS similar/family/bacterial species/length (bp) IS similar/family/bacterial species/length (bp) ISLgar4/IS6/Lc. garvieae/660 ISSth2/IS1182/S. salivarius/1897 IS1193D/ISL3/Streptococcus thermophilus/1675 IS1193/ISL3/S. thermophilus/1675 ISSmu2/ISL3/Streptococcus mutans/1453 ISSth8/ISL3/S. thermophilus/678 ISStrs1/IS200/S. salivarius/942 IS1310/IS256/Entetococcus hirae/2216 ISLpl3/IS427/Lactobacillus plantarum/872 IS1216E/IS6/Entetococcus faecium/1094 ISS1W/IS6/Lactococcus lactis/1086 IS1216V/IS6/E. hirae/1023 IS1520/IS3/L. sakei/2288 ISLpl1/IS30/L. plantarum/2020 ISPp1/IS30/Pediococcus pentosaceus/1901 ISLsa1/IS30/L. sakei/1110 ISLsa1/IS30/L. sakei/938 Active prophages Similar prophage/contig/length Similar prophage/contig/length ND a ND a Plasmids Plasmid replication origin/length Plasmid replication origin/length ND a ND a CRISPR-Cas system CRISPR spacers/cas genes/contig CRISPR spacers/cas genes/contig/level evidence ND a 7/ND/13/2 1/ND/20/1 1/ND/33/1 a ND: not detected. No prophage was predicted by the Prophage Hunter web service in S. salivarius MDI13 or in L. sakei MEI5 (Table 4). After analysis with the PlasmidFinder server, no plasmids were found in the genome of S. salivarius MDI13 and L. sakei MEI5 (Table 4). The CRISPRCas- Finder program predicted the existence of CRISPR assemblies with an evidence level of 1 Vet. Sci. 2024, 11, 365 11 of 21 and 2 in the genome of L. sakei MEI5, whereas none were detected in S. salivarius MDI13 (Table 4). 3.2.6. Identification of Operons Responsible for the Production of Bacteriocins In our study, the BAGEL4 platform and BLASTp (NCBI) database were used to identify operons associated with the production of bacteriocins and to predict their functions, re- spectively. The bioinformatic analyses with both servers allowed us to detect in the genome of S. salivarius MDI13 a cluster with the structural genes of three putative bacteriocins (SlvV, BlpK, and BlpE) belonging to the class IId, taking into account the classification proposed by Álvarez-Sieiro et al. (2016) [52] (Figure 4A). In contrast, no bacteriocin genes were identified in the genome of L. sakei MEI5. The multi-bacteriocinogenic gene cluster found in the genome of S. salivarius MDI13 (Figure 4A) showed a genetic structure similar to other blp operons characterized in S. salivarius, Streptococcus pneumoniae, and Streptococcus thermophilus, composed of genes encoding the following: (i) putative bacteriocins with the common double glycine (2-Gly) cleavage site in the leader peptides, (ii) an ATP-Binding Cassette (ABC) transporter system, (iii) a bacteriocin immunity protein, and (iv) a protein-histidine-kinase [53–59]. The identity of the predicted sequences of the three bacteriocins encoded in the genome of S. salivarius MDI13 was compared to those of the bacteriocins previously described in this species [59], using the Clustal Omega server (Figure 4B). The amino acid sequences of the bacteriocins encoded by S. salivarius MDI13 were 100% identical to those previously described [59]. However, two amino acids of the leader peptide of BlpK in S. salivarius MDI13 differed from those found in other strains (Figure 4B). Vet. Sci. 2024, 11, x FOR PEER REVIEW  12  of  22        Figure 4. (A) Gene cluster encoding the bacteriocins SlvV, BlpK, and BlpE in the genome of S. sali‐ varius MDI13 using BAGEL v.4.0. ORFs are  indicated by arrows and  their putative  functions are  indicated.  (B)  Sequence  alignment  of  the  amino  acid  sequence  of  bacteriocins  (SlvV, BlpK,  and  BlpE) detected in the genome of S. salivarius MDI13, with the amino acid sequence of bacteriocins  previously described in this species [59]. The leader sequences with the double glycine are shown  in bold. A single fully conserved residue is designated by an asterisk (*), conserved groups of res‐ idues with robustly similar properties are illustrated with a colon (:), and groups of residues that  are feebly similar are shown by a period (.).  3.3. Evaluation of Mucin Degradation, Bile Salt Deconjugation, and Biogenic Amine Production.   Neither of the two candidate probiotic LAB strains evaluated in this work showed  mucinolytic activity, the capability to deconjugate bile salts, or the ability to produce bi‐ ogenic amines.  3.4. In Vitro Cell‐Free Protein Synthesis (IV‐CFPS) of Bacteriocins and Evaluation of Their  Antimicrobial Activity  The  three bacteriocins  found  to be encoded by  the genome of S. salivarius MDI13  were  synthesized  by  an  in  vitro  cell‐free  protein  synthesis  (IV‐CFPS)  procedure  and  tested by a SOAT in order to evaluate their antimicrobial activity (Figure 5). In this sense,  the in vitro‐synthesized BlpK showed antimicrobial activity against Lc. garvieae CF00021  and S. parauberis LMG22252 (Figure 5).    In contrast, the  in vitro‐synthesized SlvV and BlpE did not show antimicrobial ac‐ tivity against any of the evaluated pathogens. Furthermore, the combination of two pep‐ tides (BlpK‐SlvV, BlpK‐BlpE, and BlpE‐SlvV) did not show synergistic activity (data not  shown); nonetheless, the inhibition zone produced by BlpK was observed in all cases.    Figure 4. (A) Gene cluster encoding the bacteriocins SlvV, BlpK, and BlpE in the genome of S. salivarius MDI13 using BAGEL v.4.0. ORFs are indicated by arrows and their putative functions are indicated. (B) Sequence alignment of the amino acid sequence of bacteriocins (SlvV, BlpK, and BlpE) detected in the genome of S. salivarius MDI13, with the amino acid sequence of bacteriocins previously described in this species [59]. The leader sequences with the double glycine are shown in bold. A single fully conserved residue is designated by an asterisk (*), conserved groups of residues with robustly similar properties are illustrated with a colon (:), and groups of residues that are feebly similar are shown by a period (.). Vet. Sci. 2024, 11, 365 12 of 21 3.3. Evaluation of Mucin Degradation, Bile Salt Deconjugation, and Biogenic Amine Production Neither of the two candidate probiotic LAB strains evaluated in this work showed mucinolytic activity, the capability to deconjugate bile salts, or the ability to produce biogenic amines. 3.4. In Vitro Cell-Free Protein Synthesis (IV-CFPS) of Bacteriocins and Evaluation of Their Antimicrobial Activity The three bacteriocins found to be encoded by the genome of S. salivarius MDI13 were synthesized by an in vitro cell-free protein synthesis (IV-CFPS) procedure and tested by a SOAT in order to evaluate their antimicrobial activity (Figure 5). In this sense, the in vitro-synthesized BlpK showed antimicrobial activity against Lc. garvieae CF00021 and S. parauberis LMG22252 (Figure 5). Vet. Sci. 2024, 11, x FOR PEER REVIEW  13  of  22        Figure 5. Antimicrobial activity of the in vitro‐synthesized bacteriocins SlvV (1), BlpK (2), and BlpE  (3) against the ictyophathogens Lc. garvieae CF00021 (A) and S. parauberis LMG22252 (B) by using a  SOAT.  4. Discussion  The development of massive sequencing platforms  together with  the reduction  in  the cost of this technique have facilitated the sequencing of a  large number of LAB ge‐ nomes from different origins, which has allowed obtaining additional information on the  potential  biotechnological  applications  of  these  bacteria  in  the  food  industry,  human  medicine, veterinary field, and animal production [60,61].  The genome analysis of  the strains studied, S. salivarius MDI13 and L. sakei MEI5,  showed  comparable annotation  characteristics, with 1952 and 1711 CDSs organized  in  219  and  197  subsystems,  respectively.  Similarly,  a  large  proportion  of  the  subsystems  have also been predicted in other genera of LAB and assigned to amino acids and deriv‐ atives, protein metabolism, and carbohydrate metabolism [62,63].  Regarding  the genetic determinants  related  to probiotic  traits, S. salivarius MDI13  and  L.  sakei MEI5 had  genes  encoding  proteins  for  the  ability  to  adhere  to  host  cells  through the gastrointestinal tract, including those encoding fibronectin‐binding protein,  exopolysaccharide (EPS), triosephosphate isomerase, and sortase A. In addition, L. sakei  MEI5 also had the enolase gene, which encodes a surface protein that mediates bacterial  adhesion  to  laminin, which  is a  suitable attribute  to be a probiotic  candidate  [64]. Re‐ garding fibronectin, this is a frequent substrate for bacterial adhesins in the host gut and  fibronectin‐binding proteins have been recognized in many different bacteria. Because of  their  adhesive property,  fibronectin‐binding proteins  from probiotic  bacteria  could  be  used for the exclusion of pathogens from the host gut and serve as a substrate for adhe‐ sion  to  the host  epithelium  and  intestinal  tract, which  is key  for  the  colonization and  persistence of bacteria in the host intestine [65]. Other studies also detected the presence  of genes encoding adhesins and sortase A in S. salivarius [66,67]. Moreover, several arti‐ cles state  that sortase A plays an  important  function  in bacterial adhesion, biofilm  for‐ mation and  immunity [68,69]. Similarly, bacterial exopolysaccharides have been associ‐ ated with  adhesion  to  surfaces  and protection  against host  immune  systems  [70]. Re‐ garding  vitamin  biosynthesis,  the RAST  software  predicted  the presence  of  genes  in‐ volved. Other studies have reported the ability of strains of L. sakei and Streptococcus spp.  to produce folate, riboflavin, and thiamine [71–74]. In this regard, other studies confirm  that LAB can synthesize essential biomolecules (e.g., vitamins or bioactive peptides) that  can  influence  the  composition, processing,  and organoleptic properties, as well  as  the  Figure 5. Antimicrobial activity of the in vitro-synthesized bacteriocins SlvV (1), BlpK (2), and BlpE (3) against the ictyophathogens Lc. garvieae CF00021 (A) and S. parauberis LMG22252 (B) by using a SOAT. In contrast, the in vitro-synthesized SlvV and BlpE did not show antimicrobial activity against any of the evaluated pathogens. Furthermore, the combination of two peptides (BlpK-SlvV, BlpK-BlpE, and BlpE-SlvV) did not show synergistic activity; nonetheless, the inhibition zone produced by BlpK was observed in all cases. 4. Discussion The development of massive sequencing platforms together with the reduction in the cost of this technique have facilitated the sequencing of a large number of LAB genomes from different origins, which has allowed obtaining additional information on the potential biotechnological applications of these bacteria in the food industry, human medicine, veterinary field, and animal production [60,61]. The genome analysis of the strains studied, S. salivarius MDI13 and L. sakei MEI5, showed comparable annotation characteristics, with 1952 and 1711 CDSs organized in 219 and 197 subsystems, respectively. Similarly, a large proportion of the subsystems have also been predicted in other genera of LAB and assigned to amino acids and derivatives, protein metabolism, and carbohydrate metabolism [62,63]. Regarding the genetic determinants related to probiotic traits, S. salivarius MDI13 and L. sakei MEI5 had genes encoding proteins for the ability to adhere to host cells through the gastrointestinal tract, including those encoding fibronectin-binding protein, exopolysac- charide (EPS), triosephosphate isomerase, and sortase A. In addition, L. sakei MEI5 also had the enolase gene, which encodes a surface protein that mediates bacterial adhesion to Vet. Sci. 2024, 11, 365 13 of 21 laminin, which is a suitable attribute to be a probiotic candidate [64]. Regarding fibronectin, this is a frequent substrate for bacterial adhesins in the host gut and fibronectin-binding proteins have been recognized in many different bacteria. Because of their adhesive prop- erty, fibronectin-binding proteins from probiotic bacteria could be used for the exclusion of pathogens from the host gut and serve as a substrate for adhesion to the host epithelium and intestinal tract, which is key for the colonization and persistence of bacteria in the host intestine [65]. Other studies also detected the presence of genes encoding adhesins and sortase A in S. salivarius [66,67]. Moreover, several articles state that sortase A plays an important function in bacterial adhesion, biofilm formation and immunity [68,69]. Similarly, bacterial exopolysaccharides have been associated with adhesion to surfaces and protection against host immune systems [70]. Regarding vitamin biosynthesis, the RAST software predicted the presence of genes involved. Other studies have reported the ability of strains of L. sakei and Streptococcus spp. to produce folate, riboflavin, and thiamine [71–74]. In this regard, other studies confirm that LAB can synthesize essential biomolecules (e.g., vitamins or bioactive peptides) that can influence the composition, processing, and organoleptic properties, as well as the overall quality of, food and feed. In addition, they can enhance synergistic effects on digestion and alleviate symptoms of intestinal malabsorption [75,76]. It has been suggested that dietary micronutrients, including B vitamins, may impact fillet texture and increase the number of muscle cells in post-smolts [77]. In addition, the synthe- sis of B group vitamins, specifically thiamine (vitamin B1), could reduce the numbers of dead and deformed fry in the probiotic-diet-fed fish [51,78]. The genome analyses also allowed the identification of genes related to amino acid biosynthesis (tryptophan, leucine, arginine, taurine, methionine, threonine, and lysine). In this sense, tryptophan is a metabolic precursor of serotonin, melatonin, and niacin (vitamin B3) which is involved in numerous physiological functions, including the modulation of behavior, antioxidant, and immune and stress responses. Aquaculture has spent years optimizing the amount of tryptophan in feed, as this is an essential aromatic amino acid that must be supplied through the fish feed [79]. In the case of leucine, this is a branched-chain amino acid, nutritionally essential in animals. This is one of the most abundant amino acids in high-quality protein feeds and is involved in energy metabolism (i.e., glucose uptake and mitochondrial biogenesis), thus providing energy for protein synthesis [80]. In this regard, approximately 80% of leucine is used for protein synthesis, [80]. Zhao et al. (2023) [81] suggested that fish feed with a diet supplemented with leucine could recover the function of the intestinal barrier by increasing antioxidant capacities, humoral immune response, and the level of tight junction protein. On the other hand, among the essential amino acids, arginine is one of the functional amino acids in animals. Specifically, arginine is an indispensable amino acid for fish, but its endogenous biosynthesis is limited. In particular, arginine specifically modulates the adenosine 5′-monophosphate (AMP)- activated protein kinase (AMPK) pathway to regulate energy balance and also activates the target of the rapamycin (TOR) signaling pathway to regulate protein synthesis [82,83]. Cysteine is a precursor of taurine, and has physiological roles, such as antioxidant stress and immune enhancement. Studies have shown that cysteine supplementation greatly increases the weight and growth rate of juvenile golden pompano (Trachinotus ovatus) [84]. Furthermore, the possibility of the reduction in mercury contamination in fish with dietary cysteine supplementation has been proposed [85]. Methionine is also an essential amino acid that stimulates protein synthesis, reduces green liver syndrome, increases cell survival, and improves digestibility and growth in some fish species, for instance rainbow trout (Oncorhynchus mykiss) and Atlantic salmon (Salmo salar) [86,87]. Genes involved in the production of lactic acid and related to stress adaptation were predicted in the genome of L. sakei MEI5. In this sense, one of the beneficial properties of lactic acid production is to hinder the survival of pathogenic bacteria [51,88–90]. The bacterial tolerance to acid and bile salts represents an adaptive advantage for probiotics, as it allows them to survive during their transit through the stomach and small intestine and, therefore, to reach the large intestine in greater numbers and with greater viability [91,92]. Vet. Sci. 2024, 11, 365 14 of 21 Regarding the safety evaluation of the two probiotic candidate LAB strains character- ized in this work, no genes encoding virulence factors were detected. Although some S. salivarius strains have been used as oral probiotics [93], a recent EFSA report has notified that this species is not recommended for the QPS list because of its potential pathogenic characteristics [15]. However, as mentioned above, bioinformatic analyses of the S. salivar- ius MDI13 genome did not identify any virulence factor. Regarding L. sakei, this species is considered potentially as safe as many other LAB species with the QPS status [94]. In- dependently of this, all strains proposed as probiotics for animals and humans should be evaluated for susceptibility to antibiotics of relevance in therapeutic practice in humans and animals [94]. In this regard, the identification of acquired transmissible antibiotic resistance(s) in a strain would automatically invalidate its use, due to the risk of spreading the resistance genes to commensal and pathogenic bacteria, which would increase the current major public health problem generated by the emergence and dissemination of antibiotic (multi)resistant bacteria [16]. In our study, no resistance genes were detected in any of the two probiotic candidates using the ResFinder 4.1 database. These results are in agreement with our previous in vitro assays in which both strains were found to be sensitive to the most commonly used antibiotics in human medicine and animal health (unpublished data). Concerning the identification of MGEs, no prophage was detected in S. salivarius MDI13 or L. sakei MEI5. This result can be considered as a positive probiotic characteristic, since some prophages may be implicated in antibiotic resistance and/or in the development of virulent characteristics [36,95]. Also, no plasmids were found in the genome of S. salivarius MDI13 and L. sakei MEI5. On the other hand, CRISPR assemblies (evidence level of 1 and 2) were found in the genome of L. sakei MEI5. In this regard, sequences with an evidence level lower than 3 were discarded as they indicate potentially invalid CRISPR assemblies [38,96]. Furthermore, the absence of associated cas genes in the predicted CRISPR arrays in the L. sakei MEI5 genome suggests the presence of orphan loci. This finding is not a surprising feature, as they have been previously described in other bacteria as remnants of previous functional CRISPR-Cas systems [97,98]. On the other hand, the strains studied do not have mucinolytic capacity. The gas- trointestinal epithelium is covered by a mucus layer that prevents the penetration of microorganisms, so bacteria with mucinolytic capacity are considered pathogenic for fish by facilitating their extraintestinal migration [11,99]. According to the FAO, the capacity to deconjugate bile salts is an advantageous characteristic in probiotics for use in humans [6]. This beneficial effect was attributed to the correlation observed amongst the capability of bacteria to deconjugate bile salts with the capability to survive in the gastrointestinal tract [100]. Although this finding was supported by later studies [101,102], there are some studies that found no relationship between survival in the presence of bile and the ability to deconjugate bile salts [103,104]. In any case, the deconjugation of bile salts makes them less effective at emulsifying ingested lipids, thereby reducing fatty acid absorption and the reabsorption of bile acids themselves [105]. Although this may be a desirable feature in human nutrition, it is not desirable in production animals, as their feed becomes less efficient. Furthermore, according to some authors, the deconjugation of bile salts can lead to the formation of toxic compounds that alter the intestinal microbiota, resulting in diarrhea, enteritis, or the activation of carcinogens in the intestinal contents [11,51,106–108]. More- over, none of the strains evaluated in this work showed the capacity to produce biogenic amines, which are organic bases of low molecular size found in various foods that can exert adverse effects with symptoms similar to allergy [43]. Histamine and tyramine have been extensively studied because of their toxic effects due to their vasoactive and psychoactive properties. In this regard, there is legislation in the European Union that regulates the presence of histamine in fish [109]. Tyramine is related to migraines and hypertensive crises in patients treated with the enzyme monoamine oxidase inhibitor. Regarding putrescine and cadaverine, the problem lies in the fact that they potentiate the effects of other biogenic amines and/or hinder their detoxification in the body [51,110–113]. Vet. Sci. 2024, 11, 365 15 of 21 The bioinformatic analyses allowed the detection of a cluster with the structural genes of three putative bacteriocins (SlvV, BlpK, and BlpE) in the genome of S. salivarius MDI13. Previous studies focused on genome mining from marine bacteria have also predicted bacteriocin gene clusters [114], including blp operons [115]. Interestingly, previous studies reported that approximately 50% of the salivaricins or related peptides are unique to S. salivarius, whereas others (e.g., BlpK) are mostly identified in other streptococcal species (e.g., S. thermophilus, S. pneumoniae, and S. pyogenes) [59]. In recent decades, a huge number of bacteriocins produced by LAB have been described [48,51,61,116]. In this regard, bac- teriocin production by LAB is considered an important probiotic antimicrobial strategy to inhibit the growth of other sensitive strains co-existing in the same ecosystem, colo- nizing their microbial community and displacing pathogens [115], and is also linked to immunostimulatory effects [117]. In our work, BlpK synthesized in vitro showed antimi- crobial activity against Lc. garvieae CF00021 and S. parauberis LMG22252. In another study, BlpK produced in vitro by a cell-free system was shown to be active against S. salivarius, S. thermophilus, and Lactococcus lactis [59]. In addition, a recombinant strain encoding BlpK exerted antimicrobial activity against phylogenetically closely related streptococcal species, and non-closely related pathogenic species, such as Listeria monocytogenes, Enterococcus faecium, Enterococcus faecalis, and Staphylococcus aureus [59]. To our knowledge, our study reports for the first time the antimicrobial activity of this broad-antimicrobial-spectrum bacteriocin against the fish pathogens Lc. garvieae and S. parauberis. Nevertheless, taking into account that the production of most bacteriocins in Streptococcus spp. is induced by transcriptional regulatory systems that require in most cases that the producer microor- ganism grows in presence of the indicator microorganism, future works will be needed to demonstrate that this bacteriocin is produced by S. salivarius MDI13 in liquid coculture with the microorganism of interest, followed by bacteriocin purification and detection by mass spectrometry. On the other hand, SlvV and BlpE did not exert antimicrobial activity against any of the evaluated pathogens. Furthermore, the combination of two peptides (BlpK-SlvV, BlpK-BlpE, and BlpE-SlvV) did not show synergistic activity. In this respect, it has been reported that the activity of fusion constructions between the expression–secretion signal of the blpK gene and the mature part of slvV and blpE in S. salivarius showed a narrow spectrum, targeting some streptococcal species, such as S. thermophilus and S. salivarius in the case of the expression of SlvV, and also Streptococcus vestibularis and Streptococcus pyogenes when expressing BlpE [59]. Therefore, the absence of the antimicrobial activity of SlvV and BlpE against the indicators tested in our study suggests that these microorganisms are not sensitive to both peptides. The results obtained in this study suggest the safety and possible probiotic potential of both strains. Nevertheless, further in vivo rearing trials and challenge tests carried out in fish are needed to validate these findings. 5. Conclusions This work highlights the importance of subjecting probiotic candidates for the food chain to WGS and bioinformatic and functional analyses. The bioinformatic analyses of the genomes of S. salivarius MDI13 and L. sakei MEI5, both strains isolated from European hakes, allowed confirming their safety and identifying genes related to their potential probiotic characteristics, including genes associated with vitamin biosynthesis adhesion and aggregation and amino acid metabolism. Specifically, in the case of L. sakei MEI5, other genes potentially related to probiotic traits were identified, such as genes related to lactic acid production, active metabolism, and adaptation to stress and adverse condi- tions in the host gastrointestinal tract. Moreover, in vitro-synthesized BlpK encoded by the genome of S. salivarius MDI13 displayed antimicrobial activity against Lc. garvieae and S. parauberis, two ichthyopathogens of utmost relevance in aquaculture. The broad antimicrobial spectrum against ichthyopathogens, the interesting probiotic properties, and the safety profile of S. salivarius MDI13 and L. sakei MEI5 reveals their potential as probiotics to prevent fish bacterial diseases in aquaculture as a complementary/alternative strategy Vet. Sci. 2024, 11, 365 16 of 21 to the use of antibiotics. However, before proposing their use as probiotics, a thorough in vivo evaluation of their safety and probiotic efficacy should be carried out. These find- ings are very promising, since aquaculture needs to have effective, safe, sustainable, and economically profitable preventive and therapeutic strategies for ichthyopathologies of relevance that will improve the health and productivity of aquaculture species and the safety of marketed products. Supplementary Materials: The following supporting information can be downloaded at: https: //www.mdpi.com/article/10.3390/vetsci11080365/s1. Table S1. Probiotic characteristics based on genome analysis. Author Contributions: Conceptualization, L.M.C. and E.M.-A.; methodology, L.D.-F., D.C., E.M.-A. and J.F.; software, L.D.-F. and D.C.; validation, J.F. and J.B.; formal analysis, L.D.-F., J.B. and J.F.; investigation, L.D.-F., E.M.-A., J.B. and D.C.; resources, J.B., P.E.H. and L.M.C.; data curation, L.D.- F.; writing—original draft preparation, L.D.-F.; writing—review and editing, E.M.-A. and L.M.C.; visualization, L.D.-F. and E.M.-A.; supervision, L.M.C. and E.M.-A.; project administration, L.M.C., P.E.H., E.M.-A. and J.B.; funding acquisition, L.M.C., J.B. and P.E.H. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded by the Ministerio de Ciencia, Innovación y Universidades (MCIU, Spain) (Projects RTI2018-094907-B-I00 and PID2019-104808RA-I00). L.D.F. received support by the Programa Investigo (Ministerio de Trabajo y Economía Social, MITES, Spain), funded by the EU (NextGenerationEU). D.C. had a research contract from the project RTI2018-094907-B-I00 (MCIU, Madrid, Spain). J.F. was supported by a FEI16/54 contract from the Universidad Complutense de Madrid (UCM, Spain) and held a predoctoral contract from the UCM. J.B. was supported by the Programa Atracción de Talento (2018-T1/BIO-10158) from the Comunidad de Madrid (Spain). Institutional Review Board Statement: Not applicable. Informed Consent Statement: Not applicable. Data Availability Statement: The whole-genome sequences of S. salivarius MDI13 and L. sakei MEI5 are deposited in GenBank under the accession numbers JAYKZL000000000 and JBEJGS000000000, respectively. Acknowledgments: We acknowledge I. Ruiz Zarzuela (Facultad de Veterinaria, Universidad de Zaragoza, Spain) and C. Michel (INRA, Jouy-en-Josas, France) for providing some of the fish pathogens. Conflicts of Interest: The authors declare no conflicts of interest. References 1. FAO (Food and Agriculture Organization of the United Nations). The State of World Fisheries and Aquaculture 2024. Blue Transformation in Action; FAO: Rome, Italy, 2024. [CrossRef] 2. Natnan, M.E.; Mayalvanan, Y.; Jazamuddin, F.M.; Aizat, W.M.; Low, C.-F.; Goh, H.-H.; Azizan, K.A.; Bunawan, H.; Baharum, S.N. Omics strategies in current advancements of infectious fish disease management. Biology 2021, 10, 1086. [CrossRef] [PubMed] 3. Hegde, A.; Kabra, S.; Basawa, R.M.; Khile, D.A.; Abbu, R.U.F.; Thomas, N.A.; Manickam, N.B.; Raval, R. Bacterial diseases in marine fish species: Current trends and future prospects in disease management. World J. Microbiol. Biotechnol. 2023, 39, 317. [CrossRef] 4. Cabello, F.C.; Godfrey, H.P.; Buschmann, A.H.; Dölz, H.J. Aquaculture as yet another environmental gateway to the development and globalisation of antimicrobial resistance. Lancet Infect. Dis. 2016, 16, e127–e133. [CrossRef] [PubMed] 5. Zhao, Y.; Yang, Q.E.; Zhou, X.; Wang, F.; Muurinen, J.; Virta, M.P.; Brandt, K.K.; Zhu, Y. Antibiotic resistome in the livestock and aquaculture industries: Status and solutions. Crit. Rev. Environ. Sci. 2021, 51, 2159–2196. [CrossRef] 6. FAO; WHO. Probióticos en los alimentos. Propiedades saludables y nutricionales y directrices para la evaluación. Estudios FAO. Alimentación y Nutrición. 2006, 85, 52. 7. Soliman, W.S.; Shaapan, R.M.; Mohamed, L.A.; Gayed, S.S.R. Recent biocontrol measures for fish bacterial diseases, in particular to probiotics, bio-encapsulated vaccines, and phage therapy. Open Vet. J. 2019, 9, 190–195. [CrossRef] 8. Abdel-Latif, H.M.R.; Dawood, M.A.O.; Menanteau-Ledouble, S.; El-Matbouli, M. The nature and consequences of co-infections in tilapia: A review. J. Fish. Dis. 2020, 43, 651–664. [CrossRef] 9. El-Saadony, M.T.; Alagawany, M.; Patra, A.K.; Kar, I.; Tiwari, R.; Dawood, M.A.O.; Dhama, K.; Abdel-Latif, H.M.R. The functionality of probiotics in aquaculture: An overview. Fish. Shellfish. Immunol. 2021, 117, 36–52. [CrossRef] https://www.mdpi.com/article/10.3390/vetsci11080365/s1 https://www.mdpi.com/article/10.3390/vetsci11080365/s1 https://doi.org/10.4060/cd0683es https://doi.org/10.3390/biology10111086 https://www.ncbi.nlm.nih.gov/pubmed/34827079 https://doi.org/10.1007/s11274-023-03755-5 https://doi.org/10.1016/S1473-3099(16)00100-6 https://www.ncbi.nlm.nih.gov/pubmed/27083976 https://doi.org/10.1080/10643389.2020.1777815 https://doi.org/10.4314/ovj.v9i3.2 https://doi.org/10.1111/jfd.13164 https://doi.org/10.1016/j.fsi.2021.07.007 Vet. Sci. 2024, 11, 365 17 of 21 10. Commission Implementing Regulation (EU) 2020/151 of 4 February 2020 concerning the authorisation of Pediococcus acidilactici CNCM I-4622 as a feed additive for all porcine species for fattening and for breeding other than sows, all avian species, all fish species and all crustaceans and repealing Regulations (EC) No 911/2009, (EU) No 1120/2010 and (EU) No 212/2011 and Implementing Regulations (EU) No 95/2013, (EU) No 413/2013 and (EU) 2017/2299 (holder of authorisation Danstar Ferment AG represented in the Union by Lallemand SAS). Off. J. Eur. Union 2020, 33, 12–15. Available online: https://eur-lex.europa.eu/ eli/reg_impl/2020/151/oj (accessed on 6 August 2024). 11. Muñoz-Atienza, E.; Gómez-Sala, B.; Araújo, C.; Campanero, C.; del Campo, R.; Hernández, P.E.; Herranz, C.; Cintas, L.M. Antimicrobial activity, antibiotic susceptibility and virulence factors of Lactic Acid Bacteria of aquatic origin intended for use as probiotics in aquaculture. BMC Microbiol. 2013, 13, 15. [CrossRef] 12. Stiles, M.E.; Holzapfel, W.H. Lactic acid bacteria of foods and their current taxonomy. Int. J. Food Microbiol. 1997, 36, 1–29. [CrossRef] [PubMed] 13. Akhter, N.; Wu, B.; Memon, A.M.; Mohsin, M. Probiotics and prebiotics associated with aquaculture: A review. Fish. Shellfish. Immunol. 2015, 45, 733–741. [CrossRef] [PubMed] 14. Banerjee, G.; Ray, A.K. Impact of microbial proteases on biotechnological industries. Biotechnol. Genet. Eng. Rev. 2017, 33, 119–143. [CrossRef] [PubMed] 15. EFSA. Statement on the update of the list of QPS-recommended microbiological agents intentionally added to food or feed as notified to EFSA 16: Suitability of taxonomic units notified to EFSA until March 2022. EFSA J. 2022, 20, 7408. [CrossRef] 16. EFSA. Statement on the update of the list of QPS-recommended biological agents intentionally added to food or feed as notified to EFSA 15: Suitability of taxonomic units notified to EFSA until September 2021. EFSA J. 2022, 20, 7045. [CrossRef] 17. Ringø, E. Probiotics in shellfish aquaculture. Aquac. Fish. 2020, 5, 1–27. [CrossRef] 18. Ringø, E.; Li, X.; Doan, H.; Ghosh, K. Interesting probiotic bacteria other than the more widely used lactic acid bacteria and bacilli in finfish. Front. Mar. Sci. 2022, 9, 848037. [CrossRef] 19. Simón, R.; Docando, F.; Nuñez-Ortiz, N.; Tafalla, C.; Díaz-Rosales, P. Mechanisms used by probiotics to confer pathogen resistance to teleost fish. Front. Immunol. 2021, 12, 653025. [CrossRef] 20. Sumon, M.A.A.; Molla, M.H.R.; Hakeem, I.J.; Ahammad, F.; Amran, R.H.; Jamal, M.T.; Gabr, M.H.; Islam, M.S.; Alam, M.T.; Brown, C.L.; et al. Epigenetics and probiotics application toward the modulation of fish reproductive performance. Fishes 2022, 7, 189. [CrossRef] 21. Hoseinifar, S.H.; Sun, Y.Z.; Wang, A.; Zhou, Z. Probiotics as means of diseases control in aquaculture, a review of current knowledge and future perspectives. Front. Microbiol. 2018, 9, 2429. [CrossRef] 22. EFSA. Statement on the requirements for whole genome sequence analysis of microorganisms intentionally used in the food chain. EFSA J. 2021, 19, 434–438. [CrossRef] 23. Mokoena, M.P. Lactic acid bacteria and their bacteriocins: Classification, biosynthesis and applications against uropathogens: A mini-review. Molecules 2017, 22, 1255. [CrossRef] [PubMed] 24. Wick, R.R.; Judd, L.M.; Gorrie, C.L.; Holt, K.E. Unicycler: Resolving bacterial genome assemblies from short and long sequencing reads. PLoS Comput. Biol. 2017, 13, e1005595. [CrossRef] [PubMed] 25. Overbeek, R.; Olson, R.; Pusch, G.D.; Olsen, G.J.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Parrello, B.; Shukla, M.; et al. The SEED and the Rapid Annotation of microbial genomes using Subsystems Technology (RAST). Nucleic Acids Res. 2014, 42, 206–214. [CrossRef] [PubMed] 26. Grant, J.R.; Enns, E.; Marinier, E.; Mandal, A.; Herman, E.K.; Chen, C.Y.; Graham, M.; Van Domselaar, G.; Stothard, P. Proksee: In-depth characterization and visualization of bacterial genomes. Nucleic Acids Res. 2023, 51, W484–W492. [CrossRef] [PubMed] 27. Larsen, M.V.; Cosentino, S.; Lukjancenko, O.; Saputra, D.; Rasmussen, S.; Hasman, H.; Sicheritz-Pontén, T.; Aarestrup, F.M.; Ussery, D.W.; Lund, O. Benchmarking of methods for genomic taxonomy. J. Clin. Microbiol. 2014, 52, 1529–1539. [CrossRef] [PubMed] 28. Hasman, H.; Saputra, D.; Sicheritz-Ponten, T.; Lund, O.; Svendsen, C.A.; Frimodt-Møller, N.; Aarestrup, F.M. Rapid whole-genome sequencing for detection and characterization of microorganisms directly from clinical samples. J. Clin. Microbiol. 2014, 52, 139–146. [CrossRef] [PubMed] 29. Van Heel, A.J.; de Jong, A.; Song, C.; Viel, J.H.; Kok, J.; Kuipers, O.P. BAGEL4: A user-friendly web server to thoroughly mine RiPPs and bacteriocins. Nucleic Acids Res. 2018, 46, 278–281. [CrossRef] 30. Singh, H.; Raghava, G.P. BLAST-based structural annotation of protein residues using Protein Data Bank. Biol. Direct. 2016, 11, 4. [CrossRef] 31. Gibson, T.J.; Karplus, K.; Li, W.; Lopez, R.; McWilliam, H.; Remmert, M.; Söding, J.; Thompson, J.D.; Higgins, D.G. Fast, scalable generation of high-quality protein multiple sequence alignments using Clustal Omega. Mol. Syst. Biol. 2011, 7, 539. [CrossRef] 32. Joensen, K.G.; Scheutz, F.; Lund, O.; Hasman, H.; Kaas, R.S.; Nielsen, E.M.; Aarestrup, F.M. Real-time whole-genome sequencing for routine typing, surveillance, and outbreak detection of verotoxigenic Escherichia coli. J. Clin. Microbiol. 2014, 52, 1501–1510. [CrossRef] [PubMed] 33. Bortolaia, V.; Kaas, R.F.; Ruppe, E.; Roberts, M.C.; Schwarz, S.; Cattoir, V.; Philippon, A.; Allesoe, R.L.; Rebelo, A.R.; Florensa, A.F.; et al. ResFinder 4.0 for predictions of phenotypes from genotypes. J. Antimicrob. Chemother. 2020, 75, 3491–3500. [CrossRef] [PubMed] https://eur-lex.europa.eu/eli/reg_impl/2020/151/oj https://eur-lex.europa.eu/eli/reg_impl/2020/151/oj https://doi.org/10.1186/1471-2180-13-15 https://doi.org/10.1016/S0168-1605(96)01233-0 https://www.ncbi.nlm.nih.gov/pubmed/9168311 https://doi.org/10.1016/j.fsi.2015.05.038 https://www.ncbi.nlm.nih.gov/pubmed/26044743 https://doi.org/10.1080/02648725.2017.1408256 https://www.ncbi.nlm.nih.gov/pubmed/29205093 https://doi.org/10.2903/j.efsa.2022.7408 https://doi.org/10.2903/j.efsa.2022.7045 https://doi.org/10.1016/j.aaf.2019.12.001 https://doi.org/10.3389/fmars.2022.848037 https://doi.org/10.3389/fimmu.2021.653025 https://doi.org/10.3390/fishes7040189 https://doi.org/10.3389/fmicb.2018.02429 https://doi.org/10.2903/j.efsa.2021.6506 https://doi.org/10.3390/molecules22081255 https://www.ncbi.nlm.nih.gov/pubmed/28933759 https://doi.org/10.1371/journal.pcbi.1005595 https://www.ncbi.nlm.nih.gov/pubmed/28594827 https://doi.org/10.1093/nar/gkt1226 https://www.ncbi.nlm.nih.gov/pubmed/24293654 https://doi.org/10.1093/nar/gkad326 https://www.ncbi.nlm.nih.gov/pubmed/37140037 https://doi.org/10.1128/JCM.02981-13 https://www.ncbi.nlm.nih.gov/pubmed/24574292 https://doi.org/10.1128/JCM.02452-13 https://www.ncbi.nlm.nih.gov/pubmed/24172157 https://doi.org/10.1093/nar/gky383 https://doi.org/10.1186/s13062-016-0106-9 https://doi.org/10.1038/msb.2011.75 https://doi.org/10.1128/JCM.03617-13 https://www.ncbi.nlm.nih.gov/pubmed/24574290 https://doi.org/10.1093/jac/dkaa345 https://www.ncbi.nlm.nih.gov/pubmed/32780112 Vet. Sci. 2024, 11, 365 18 of 21 34. Cosentino, S.; Larsen, M.V.; Aarestrup, F.M.; Lund, O. PathogenFinder—Distinguishing friend from foe using bacterial Whole Genome Sequence data. PLoS ONE 2013, 8, e77302. [CrossRef] [PubMed] 35. Siguier, P.; Perochon, J.; Lestrade, L.; Mahillon, J.; Chandler, M. ISfinder: The reference centre for bacterial insertion sequences. Nucleic. Acids Res. 2006, 34, D32–D36. [CrossRef] [PubMed] 36. Song, W.; Sun, H.X.; Zhang, C.; Cheng, L.; Peng, Y.; Deng, Z.; Wang, D.; Wang, Y.; Hu, M.; Liu, W.; et al. Prophage Hunter: An integrative hunting tool for active prophages. Nucleic Acids Res. 2019, 47, 74–80. [CrossRef] 37. Carattoli, A.; Zankari, E.; García-Fernández, A.; Voldby Larsen, M.; Lund, O.; Villa, L.; Møller Aarestrup, F.; Hasman, H. In silico detection and typing of plasmids using PlasmidFinder and plasmid multilocus sequence typing. Antimicrob. Agents. Chemother. 2014, 58, 3895–3903. [CrossRef] [PubMed] 38. Couvin, D.; Bernheim, A.; Toffano-Nioche, C.; Touchon, M.; Michalik, J.; Néron, B.; Rocha, E.P.C.; Vergnaud, G.; Gautheret, D.; Pourcel, C. CRISPRCasFinder, an update of CRISRFinder, includes a portable version, enhanced performance and integrates search for Cas proteins. Nucleic. Acids Res. 2018, 46, 246–251. [CrossRef] [PubMed] 39. Meier-Kolthoff, J.P.; Göker, M. TYGS is an automated high-throughput platform for state-of-the-art genome-based taxonomy. Nat. Commun. 2019, 10, 2182. [CrossRef] [PubMed] 40. Noriega, L.; Cuevas, I.; Margolles, A.; de los Reyes-Gavilán, C.G. Deconjugation and bile salts hydrolase activity by Bifidobac- terium strains with acquired resistance to bile. Int. Dairy. J. 2006, 16, 850–855. [CrossRef] 41. Zhou, J.S.; Gopal, P.K.; Gill, H.S. Potential probiotic lactic acid bacteria Lactobacillus rhamnosus (HN001), Lactobacillus acidophilus (HN017) and Bifidobacterium lactis (HN019) do not degrade gastric mucin in vitro. Int. J. Food Microbiol. 2001, 63, 81–90. [CrossRef] 42. Le Jeune, C.; Lonvaud-Funel, A.; ten Brink, B.; Hofstra, H.; van der Vossen, J.M. Development of a detection system for histidine decarboxylating lactic acid bacteria based on DNA probes, PCR and activity test. J. Appl. Bacteriol. 1995, 78, 316–326. [CrossRef] [PubMed] 43. Coton, M.; Coton, E.; Lucas, P.; Lonvaud, A. Identification of the gene encoding a putative tyrosine decarboxylase of Carnobacterium divergens 508. Development of molecular tools for the detection of tyramine-producing bacteria. Food Microbiol. 2004, 21, 125–130. [CrossRef] 44. Marcobal, A.; de las Rivas, B.; Moreno-Arribas, M.V.; Muñoz, R. Multiplex PCR method for the simultaneous detection of histamine-, tyramine-, and putrescine-producing lactic acid bacteria in foods. J. Food Prot. 2005, 68, 874–878. [CrossRef] 45. De las Rivas, B.; Marcobal, A.; Carrascosa, A.V.; Muñoz, R. PCR detection of foodborne bacteria producing the biogenic amines histamine, tyramine, putrescine, and cadaverine. J. Food Prot. 2006, 69, 2509–2514. [CrossRef] [PubMed] 46. Gabant, P.; Borrero, J. PARAGEN 1.0: A standardized synthetic gene library for fast cell-free bacteriocin synthesis. Front. Bioeng. Biotechnol. 2019, 7, 213. [CrossRef] [PubMed] 47. Montalbán-López, M.; Scott, T.A.; Ramesh, S.; Rahman, I.R.; van Heel, A.J.; Viel, J.H.; Bandarian, V.; Dittmann, E.; Genilloud, O.; Goto, Y.; et al. New developments in RiPP discovery, enzymology and engineering. Nat. Prod. Rep. 2021, 38, 130–239. [CrossRef] [PubMed] 48. Sevillano, E.; Peña, N.; Lafuente, I.; Cintas, L.M.; Muñoz-Atienza, E.; Hernández, P.E.; Borrero, J. Nisin S, a novel Nisin variant produced by Ligilactobacillus salivarius P1CEA3. Int. J. Mol. Sci. 2023, 24, 6813. [CrossRef] [PubMed] 49. Cintas, L.M.; Casaus, P.; Holo, H.; Hernández, P.E.; Nes, I.F.; Håvarstein, L.S. Enterocins L50A and L50B, two novel bacteriocins from Enterococcus faecium L50, are related to staphylococcal hemolysins. J. Bacteriol. 1998, 180, 1988–1994. [CrossRef] 50. Díaz-Formoso, L.; Silva, V.; Contente, D.; Feito, J.; Hernández, P.E.; Borrero, J.; Igrejas, G.; Del Campo, R.; Muñoz-Atienza, E.; Poeta, P.; et al. Antibiotic resistance genes, virulence factors, and biofilm formation in coagulase-negative Staphylococcus spp. isolates from European hakes (Merluccius merluccius, L.) caught in the Northeast Atlantic Ocean. Pathogens 2023, 12, 1447. [CrossRef] 51. Feito, J.; Contente, D.; Ponce-Alonso, M.; Díaz-Formoso, L.; Araújo, C.; Peña, N.; Borrero, J.; Gómez-Sala, B.; del Campo, R.; Muñoz-Atienza, E.; et al. Draft genome sequence of Lactococcus lactis subsp. cremoris WA2-67: A promising Nisin-producing probiotic strain isolated from the rearing environment of a Spanish rainbow trout (Oncorhynchus mykiss, Walbaum) farm. Microorganisms 2022, 10, 521. [CrossRef] 52. Álvarez-Sieiro, P.; Montalbán-López, M.; Mu, D.; Kuipers, O.P. Bacteriocins of lactic acid bacteria: Extending the family. Appl. Microbiol. Biotechnol. 2016, 100, 2939–2951. [CrossRef] [PubMed] 53. Hols, P.; Hancy, F.; Fontaine, L.; Grossiord, B.; Prozzi, D.; Leblond-Bourget, N.; Decaris, B.; Bolotin, A.; Delorme, C.; Dusko Ehrlich, S.; et al. New insights in the molecular biology and physiology of Streptococcus thermophilus revealed by comparative genomics. FEMS Microbiol. Rev. 2005, 29, 435–463. [CrossRef] [PubMed] 54. Son, M.R.; Shchepetov, M.; Adrian, P.V.; Madhi, S.A.; de Gouveia, L.; von Gottberg, A.; Klugman, K.P.; Weiser, J.N.; Dawid, S. Conserved mutations in the pneumococcal bacteriocin transporter gene, blpA, result in a complex population consisting of producers and cheaters. mBio 2011, 2, e00179-11. [CrossRef] [PubMed] 55. Renye, J.A.; Somkuti, G.A. BlpC-regulated bacteriocin production in Streptococcus thermophilus. Biotechnol. Lett. 2013, 35, 407–412. [CrossRef] [PubMed] 56. Valente, C.; Dawid, S.; Pinto, F.R.; Hinds, J.; Simões, A.S.; Gould, K.A.; Mendes, L.A.; de Lencastre, H.; Sá-Leão, R. The blp locus of Streptococcus pneumoniae plays a limited role in the selection of strains that can cocolonize the human nasopharynx. Appl. Environ. Microbiol. 2016, 82, 5206–5215. [CrossRef] [PubMed] https://doi.org/10.1371/journal.pone.0077302 https://www.ncbi.nlm.nih.gov/pubmed/24204795 https://doi.org/10.1093/nar/gkj014 https://www.ncbi.nlm.nih.gov/pubmed/16381877 https://doi.org/10.1093/nar/gkz380 https://doi.org/10.1128/AAC.02412-14 https://www.ncbi.nlm.nih.gov/pubmed/24777092 https://doi.org/10.1093/nar/gky425 https://www.ncbi.nlm.nih.gov/pubmed/29790974 https://doi.org/10.1038/s41467-019-10210-3 https://www.ncbi.nlm.nih.gov/pubmed/31097708 https://doi.org/10.1016/j.idairyj.2005.09.008 https://doi.org/10.1016/S0168-1605(00)00398-6 https://doi.org/10.1111/j.1365-2672.1995.tb05032.x https://www.ncbi.nlm.nih.gov/pubmed/7730207 https://doi.org/10.1016/j.fm.2003.10.004 https://doi.org/10.4315/0362-028X-68.4.874 https://doi.org/10.4315/0362-028X-69.10.2509 https://www.ncbi.nlm.nih.gov/pubmed/17066936 https://doi.org/10.3389/fbioe.2019.00213 https://www.ncbi.nlm.nih.gov/pubmed/31552239 https://doi.org/10.1039/D0NP00027B https://www.ncbi.nlm.nih.gov/pubmed/32935693 https://doi.org/10.3390/ijms24076813 https://www.ncbi.nlm.nih.gov/pubmed/37047785 https://doi.org/10.1128/JB.180.8.1988-1994.1998 https://doi.org/10.3390/pathogens12121447 https://doi.org/10.3390/microorganisms10030521 https://doi.org/10.1007/s00253-016-7343-9 https://www.ncbi.nlm.nih.gov/pubmed/26860942 https://doi.org/10.1016/j.femsre.2005.04.008 https://www.ncbi.nlm.nih.gov/pubmed/16125007 https://doi.org/10.1128/mBio.00179-11 https://www.ncbi.nlm.nih.gov/pubmed/21896678 https://doi.org/10.1007/s10529-012-1095-0 https://www.ncbi.nlm.nih.gov/pubmed/23183916 https://doi.org/10.1128/AEM.01048-16 https://www.ncbi.nlm.nih.gov/pubmed/27316956 Vet. Sci. 2024, 11, 365 19 of 21 57. Vertillo Aluisio, G.; Spitale, A.; Bonifacio, L.; Privitera, G.F.; Stivala, A.; Stefani, S.; Santagati, M. Streptococcus salivarius 24SMBc genome analysis reveals new biosynthetic gene clusters involved in antimicrobial effects on Streptococcus pneumoniae and Streptococcus pyogenes. Microorganisms 2022, 10, 2042. [CrossRef] [PubMed] 58. Rozman, V.; Mohar Lorbeg, P.; Chanishvili, N.; Accetto, T.; Kakabadze, E.; Grdzelishvili, N.; Rupnik, M.; Matijasic, B. Genomic insights into the safety and bacteriocinogenic potential of isolates from artisanal fermented milk Matsoni. LWT Food Sci. Technol. 2023, 185, 115183. [CrossRef] 59. Damoczi, J.; Knoops, A.; Martou, M.S.; Jamaux, F.; Gabant, P.; Mahillon, J.; Mignolet, J.; Hols, P. Uncovering the class II-bacteriocin predatiome in salivarius streptococci. bioRxiv 2024. [CrossRef] 60. Mileriene, J.; Aksomaitiene, J.; Kondrotiene, K.; Asledottir, T.; Vegarud, G.E.; Serniene, L.; Malakauskas, M. Whole-Genome Sequence of Lactococcus lactis subsp. lactis LL16 confirms safety, probiotic potential, and reveals functional traits. Microorganisms 2023, 11, 1034. [CrossRef] 61. Contente, D.; Díaz-Formoso, L.; Feito, J.; Hernández, P.E.; Muñoz-Atienza, E.; Borrero, J.; Poeta, P.; Cintas, L.M. Genomic and functional evaluation of two Lacticaseibacillus paracasei and two Lactiplantibacillus plantarum strains, isolated from a rearing tank of rotifers (Brachionus plicatilis), as probiotics for aquaculture. Genes 2024, 15, 64. [CrossRef] 62. Pakroo, S.; Tarrah, A.; Takur, R.; Wu, M.; Corich, V.; Giacomini, A. Limosilactobacillus fermentum ING8, a potential multifunctional non-starter strain with relevant technological properties and antimicrobial activity. Foods 2022, 11, 703. [CrossRef] [PubMed] 63. Nguyen, T.L.; Kim, D.-H. Genome-wide comparison reveals a probiotic strain Lactococcus lactis WFLU12 isolated from the gastrointestinal tract of olive flounder (Paralichthys olivaceus) harboring genes supporting probiotic action. Mar. Drugs 2018, 16, 140. [CrossRef] [PubMed] 64. Granato, D.; Bergonzelli, G.E.; Pridmore, R.D.; Marvin, L.; Rouvet, M.; Corthésy-Theulaz, I.E. Cell surface-associated elongation factor Tu mediates the attachment of Lactobacillus johnsonii NCC533 (La1) to human intestinal cells and mucins. Infect. Immun. 2004, 72, 2160–2169. [CrossRef] [PubMed] 65. Bisht, S.; Singh, K.S.; Choudhary, R.; Kumar, S.; Grover, S.; Mohanty, A.K.; Pande, V.; Kaushik, J.K. Expression of fibronectin- binding protein of L. acidophilus NCFM and in vitro refolding to adhesion capable native-like protein from inclusion bodies. Protein Expr. Purif. 2018, 145, 7–13. [CrossRef] [PubMed] 66. Couvigny, B.; Kulakauskas, S.; Pons, N.; Quinquis, B.; Abraham, A.-L.; Meylheuc, T.; Delorme, C.; Renault, P.; Briandet, B.; Lapaque, N.; et al. Identification of new factors modulating adhesion abilities of the pioneer commensal bacterium Streptococcus salivarius. Front. Microbiol. 2018, 9, 273. [CrossRef] [PubMed] 67. Chaffanel, F.; Charron-Bourgoin, F.; Soligot, C.; Kebouchi, M.; Bertin, S.; Payot, S.; Le Roux, Y.; Leblond-Bourget, N. Surface proteins involved in the adhesion of Streptococcus salivarius to human intestinal epithelial cells. Appl. Microbiol. Biotechnol. 2018, 102, 2851–2865. [CrossRef] [PubMed] 68. Jensen, H.; Roos, S.; Jonsson, H.; Rud, I.; Grimmer, S.; van Pijkeren, J.P.; Britton, R.A.; Axelsson, L. Role of Lactobacillus reuteri cell and mucus-binding protein A (CmbA) in adhesion to intestinal epithelial cells and mucus in vitro. Microbiology 2014, 160, 671–681. [CrossRef] 69. Wang, L.; Wang, G.; Qu, H.; Wang, K.; Jing, S.; Guan, S.; Su, L.; Li, Q.; Wang, D. Taxifolin, an inhibitor of Sortase A, interferes with the adhesion of methicillin-resistant Staphylococcal aureus. Front. Microbiol. 2021, 12, 686864. [CrossRef] [PubMed] 70. Low, K.E.; Howell, P.L. Gram-negative synthase-dependent exopolysaccharide biosynthetic machines. Curr. Opin. Struct. Biol. 2018, 53, 32–44. [CrossRef] 71. Burghout, P.; Zomer, A.; van der Gaast-de Jongh, C.E.; Janssen-Megens, E.M.; Françoijs, K.J.; Stunnenberg, H.G.; Hermans, P.W. Streptococcus pneumoniae folate biosynthesis responds to environmental CO2 levels. J. Bacteriol. 2013, 195, 1573–1582. [CrossRef] 72. Liu, S.; Sun, Y.; Liu, Y.; Hu, F.; Xu, L.; Zheng, Q.; Wang, Q.; Zeng, G.; Zhang, K. Genomic and phenotypic characterization of Streptococcus mutans isolates suggests key gene clusters in regulating its interaction with Streptococcus gordonii. Front. Microbiol. 2022, 13, 945108. [CrossRef] 73. Liu, M.; Chen, Q.; Sun, Y.; Zeng, L.; Wu, H.; Gu, Q.; Li, P. Probiotic potential of a folate-producing strain Latilactobacillus sakei LZ217 and its modulation effects on human gut microbiota. Foods. 2022, 11, 234. [CrossRef] 74. Vidal Amaral, J.R.; Jucá Ramos, R.T.; Almeida Araújo, F.; Bentes Kato, R.; Figueira Aburjaile, F.; de Castro Soares, S.; Góes-Neto, A.; Matiuzzi da Costa, M.; Azevedo, V.; Brenig, B.; et al. Bacteriocin producing Streptococcus agalactiae strains isolated from bovine mastitis in Brazil. Microorganisms. 2022, 10, 588. [CrossRef] [PubMed] 75. Patel, A.; Shah, N.; Prajapati, J.B. Biosynthesis of vitamins and enzymes in fermented foods by lactic acid bacteria and related genera—A promising approach. Croat. J. Food Sci. Technol. 2013, 5, 85–91. Available online: https://hrcak.srce.hr/113693 (accessed on 6 August 2024). 76. Chen, S.; Zhang, F.; Ananta, E.; Muller, J.A.; Liang, Y.; Lee, Y.K.; Liu, S. Inoculation of Latilactobacillus sakei with Pichia kluyveri or Saccharomyces boulardii improves flavor compound profiles of salt-free fermented wheat-gluten: Effects from single strain inoculation. Curr. Res. Food. Sci. 2023, 6, 100492. [CrossRef] [PubMed] 77. Adam, A.C.; Saito, T.; Espe, M.; Whatmore, P.; Fernandes, J.M.O.; Vikeså, V.; Skjærven, K.H. Metabolic and molecular signatures of improved growth in Atlantic salmon (Salmo salar) fed surplus levels of methionine, folic acid, vitamin B6 and B12 throughout smoltification. Br. J. Nutr. 2022, 127, 1289–1302. [CrossRef] 78. Ghosh, S.; Sinha, A.; Sahu, C. Effect of probiotic on reproductive performance in female livebearing ornamental fish. Aquac. Res. 2007, 38, 518–526. [CrossRef] https://doi.org/10.3390/microorganisms10102042 https://www.ncbi.nlm.nih.gov/pubmed/36296318 https://doi.org/10.1016/j.lwt.2023.115183 https://doi.org/10.1101/2024.03.04.583286 https://doi.org/10.3390/microorganisms11041034 https://doi.org/10.3390/genes15010064 https://doi.org/10.3390/foods11050703 https://www.ncbi.nlm.nih.gov/pubmed/35267336 https://doi.org/10.3390/md16050140 https://www.ncbi.nlm.nih.gov/pubmed/29695124 https://doi.org/10.1128/IAI.72.4.2160-2169.2004 https://www.ncbi.nlm.nih.gov/pubmed/15039339 https://doi.org/10.1016/j.pep.2017.11.007 https://www.ncbi.nlm.nih.gov/pubmed/29229289 https://doi.org/10.3389/fmicb.2018.00273 https://www.ncbi.nlm.nih.gov/pubmed/29515553 https://doi.org/10.1007/s00253-018-8794-y https://www.ncbi.nlm.nih.gov/pubmed/29442170 https://doi.org/10.1099/mic.0.073551-0 https://doi.org/10.3389/fmicb.2021.686864 https://www.ncbi.nlm.nih.gov/pubmed/34295320 https://doi.org/10.1016/j.sbi.2018.05.001 https://doi.org/10.1128/JB.01942-12 https://doi.org/10.3389/fmicb.2022.945108 https://doi.org/10.3390/foods11020234 https://doi.org/10.3390/microorganisms10030588 https://www.ncbi.nlm.nih.gov/pubmed/35336163 https://hrcak.srce.hr/113693 https://doi.org/10.1016/j.crfs.2023.100492 https://www.ncbi.nlm.nih.gov/pubmed/37033740 https://doi.org/10.1017/S0007114521002336 https://doi.org/10.1111/j.1365-2109.2007.01696.x Vet. Sci. 2024, 11, 365 20 of 21 79. Hoseini, S.M.; Pérez-Jiménez, A.; Costas, B.; Azeredo, R.; Gesto, M. Physiological roles of tryptophan in teleosts: Current knowledge and perspectives for future studies. Rev. Aquac. 2019, 11, 3–24. [CrossRef] 80. Duan, Y.; Li, F.; Li, Y.; Tang, Y.; Kong, X.; Feng, Z.; Anthony, T.G.; Watford, M.; Hou, W.; Wu, G.; et al. The role of leucine and its metabolites in protein and energy metabolism. Amino Acids. 2016, 48, 41–51. [CrossRef] 81. Zhao, J.; Zhao, Y.; Liu, H.; Cao, Q.; Feng, L.; Zhang, Z.; Jiang, W.; Wu, P.; Liu, J.; Luo, W.; et al. Dietary leucine improves fish intestinal barrier function by increasing humoral immunity, antioxidant capacity, and tight junction. Int. J. Mol. Sci. 2023, 24, 4716. [CrossRef] 82. Hoseini, S.M.; Khan, M.A.; Yousefi, M.; Costas, B. Roles of arginine in fish nutrition and health: Insights for future researches. Rev. Aquac. 2020, 12, 2091–2108. [CrossRef] 83. Wang, Q.; Xu, Z.; Ai, Q. Arginine metabolism and its functions in growth, nutrient utilization, and immunonutrition of fish. Anim. Nutr. 2021, 7, 716–727. [CrossRef] [PubMed] 84. Liu, J.X.; Zhu, K.C.; Guo, H.Y.; Liu, B.S.; Zhang, N.; Zhang, D.C. Effects of cysteine addition to low-fishmeal diets on the growth, anti-oxidative stress, intestine immunity, and Streptococcus agalactiae resistance in juvenile golden pompano (Trachinotus ovatus). Front. Immunol. 2022, 13, 1066936. [CrossRef] [PubMed] 85. Mok, W.J.; Hatanaka, Y.; Seoka, M.; Itoh, T.; Tsukamasa, Y.; Ando, M. Effects of additional cysteine in fish diet on mercury concentration. Food Chem. 2014, 147, 340–345. [CrossRef] [PubMed] 86. Belghit, I.; Skiba-Cassy, S.; Geurden, I.; Dias, K.; Surget, A.; Kaushik, S.; Panserat, S.; Seiliez, I. Dietary methionine availability affects the main factors involved in muscle protein turnover in rainbow trout (Oncorhynchus mykiss). Br. J. Nutr. 2014, 112, 493–503. [CrossRef] [PubMed] 87. Andersen, S.M.; Waagbø, R.; Espe, M. Functional amino acids in fish nutrition, health and welfare. Front. Biosci. (Elite Ed.). 2016, 8, 143–169. [CrossRef] [PubMed] 88. Chang, D.E.; Jung, H.C.; Rhee, J.S.; Pan, J.G. Homofermentative production of D- or L-lactate in metabolically engineered Escherichia coli RR1. Appl. Environ. Microbiol. 1999, 65, 1384–1389. [CrossRef] [PubMed] 89. Zhang, H.; HuangFu, H.; Wang, X.; Zhao, S.; Liu, Y.; Lv, H.; Qin, G.; Tan, Z. Antibacterial activity of lactic acid producing Leuconostoc mesenteroides QZ1178 against pathogenic Gallibacterium anatis. Front. Vet. Sci. 2021, 8, 630294. [CrossRef] 90. Alayande, K.A.; Aiyegoro, O.A.; Nengwekhulu, T.M.; Katata-Seru, L.; Ateba, C.N. Integrated genome-based probiotic relevance and safety evaluation of Lactobacillus reuteri PNW1. PLoS ONE 2020, 15, e0235873. [CrossRef] 91. Tuomola, E.; Crittenden, R.; Playne, M.; Isolauri, E.; Salminen, S. Quality assurance criteria for probiotic bacteria. Am. J. Clin. Nutr. 2001, 73, 393S–398S. [CrossRef] 92. Oliveira, L.C.; Saraiva, T.D.; Silva, W.M.; Pereira, U.P.; Campos, B.C.; Benevides, L.J.; Rocha, F.S.; Figueiredo, H.C.; Azevedo, V.; Soares, S.C. Analyses of the probiotic property and stress resistance-related genes of Lactococcus lactis subsp. lactis NCDO 2118 through comparative genomics and in vitro assays. PLoS ONE 2017, 12, e0175116. [CrossRef] [PubMed] 93. Heng, N.C.; Haji-Ishak, N.S.; Kalyan, A.; Wong, A.Y.; Lovric, M.; Bridson, J.M.; Artamonova, J.; Stanton, J.A.; Wescombe, P.A.; Burton, J.P.; et al. Genome sequence of the bacteriocin-producing oral probiotic Streptococcus salivarius strain M18. J. Bacteriol. 2011, 193, 6402–6403. [CrossRef] [PubMed] 94. EFSA. Guidance on the characterisation of microorganisms used as feed additives or as production organisms. EFSA J. 2018, 16, 5206. [CrossRef] 95. Argov, T.; Azulay, G.; Pasechnek, A.; Stadnyuk, O.; Ran-Sapir, S.; Borovok, I.; Sigal, N.; Herskovits, A.A. Temperate bacteriophages as regulators of host behavior. Curr. Opin. Microbiol. 2017, 38, 81–87. [CrossRef] [PubMed] 96. Makarova, K.S.; Wolf, Y.I.; Iranzo, J.; Shmakov, S.A.; Alkhnbashi, O.S.; Brouns, S.J.J.; Charpentier, E.; Cheng, D.; Haft, D.H.; Horvath, P.; et al. Evolutionary classification of CRISPR-Cas systems: A burst of class 2 and derived variants. Nat. Rev. Microbiol. 2020, 18, 67–83. [CrossRef] 97. Katyal, I.; Chaban, B.; Ng, B.; Hill, J.E. CRISPRs of Enterococcus faecalis and E. hirae isolates from pig feces have species-specific repeats but share some common spacer sequences. Microb. Ecol. 2013, 66, 182–188. [CrossRef] [PubMed] 98. Butiuc-Keul, A.; Farkas, A.; Carpa, R.; Iordache, D. CRISPR-Cas System: The powerful modulator of accessory genomes in prokaryotes. Microb. Physiol. 2022, 32, 2–17. [CrossRef] [PubMed] 99. Ruseler-van Embden, J.; van Lieshout, L.; Gosselink, M.J.; Marteau, P. Inability of Lactobacillus casei strain GG, L. acidophilus, and Bifidobacterium bifidum to degrade intestinal mucus glycoproteins. Scand. J. Gastroenterol. 1995, 30, 675–680. [CrossRef] [PubMed] 100. Conway, P.L.; Gorbach, S.L.; Goldin, B.R. Survival of lactic acid bacteria in the human stomach and adhesion to intestinal cells. J. Dairy Sci. 1987, 70, 1–12. [CrossRef] 101. De Smet, I.; Van Hoorde, L.; Vande Woestyne, M.; Christiaens, H.; Verstraete, W. Significance of bile salt hydrolytic activities of lactobacilli. J. Appl. Bacteriol. 1995, 79, 292–301. [CrossRef] 102. Grill, J.P.; Cayuela, C.; Antoine, J.M.; Schneider, F. Isolation and characterization of a Lactobacillus amylovorus mutant depleted in conjugated bile salt hydrolase activity: Relation between activity and bile salt resistance. J. Appl. Microbiol. 2000, 89, 553–563. [CrossRef] 103. Usman Hosono, A. Bile tolerance, taurocholate deconjugation, and binding of cholesterol by Lactobacillus gasseri strains. J. Dairy Sci. 1999, 82, 243–248. [CrossRef] [PubMed] 104. Moser, S.A.; Savage, D.C. Bile salt hydrolase activity and resistance to toxicity of conjugated bile salts are unrelated properties in lactobacilli. Appl. Environ. Microbiol. 2001, 67, 3476–3480. [CrossRef] [PubMed] https://doi.org/10.1111/raq.12223 https://doi.org/10.1007/s00726-015-2067-1 https://doi.org/10.3390/ijms24054716 https://doi.org/10.1111/raq.12424 https://doi.org/10.1016/j.aninu.2021.03.006 https://www.ncbi.nlm.nih.gov/pubmed/34466676 https://doi.org/10.3389/fimmu.2022.1066936 https://www.ncbi.nlm.nih.gov/pubmed/36466908 https://doi.org/10.1016/j.foodchem.2013.09.157 https://www.ncbi.nlm.nih.gov/pubmed/24206728 https://doi.org/10.1017/S0007114514001226 https://www.ncbi.nlm.nih.gov/pubmed/24877663 https://doi.org/10.2741/757 https://www.ncbi.nlm.nih.gov/pubmed/26709652 https://doi.org/10.1128/AEM.65.4.1384-1389.1999 https://www.ncbi.nlm.nih.gov/pubmed/10103226 https://doi.org/10.3389/fvets.2021.630294 https://doi.org/10.1371/journal.pone.0235873 https://doi.org/10.1093/ajcn/73.2.393s https://doi.org/10.1371/journal.pone.0175116 https://www.ncbi.nlm.nih.gov/pubmed/28384209 https://doi.org/10.1128/JB.06001-11 https://www.ncbi.nlm.nih.gov/pubmed/22038965 https://doi.org/10.2903/j.efsa.2018.5206 https://doi.org/10.1016/j.mib.2017.05.002 https://www.ncbi.nlm.nih.gov/pubmed/28544996 https://doi.org/10.1038/s41579-019-0299-x https://doi.org/10.1007/s00248-013-0217-0 https://www.ncbi.nlm.nih.gov/pubmed/23535981 https://doi.org/10.1159/000516643 https://www.ncbi.nlm.nih.gov/pubmed/34192695 https://doi.org/10.3109/00365529509096312 https://www.ncbi.nlm.nih.gov/pubmed/7481531 https://doi.org/10.3168/jds.S0022-0302(87)79974-3 https://doi.org/10.1111/j.1365-2672.1995.tb03140.x https://doi.org/10.1046/j.1365-2672.2000.01147.x https://doi.org/10.3168/jds.S0022-0302(99)75229-X https://www.ncbi.nlm.nih.gov/pubmed/10068945 https://doi.org/10.1128/AEM.67.8.3476-3480.2001 https://www.ncbi.nlm.nih.gov/pubmed/11472922 Vet. Sci. 2024, 11, 365 21 of 21 105. Begley, M.; Gahan, C.G.; Hill, C. The interaction between bacteria and bile. FEMS Microbiol. Rev. 2005, 29, 625–651. [CrossRef] 106. Marteau, P.; Gerhardt, M.; Myara, A.; Bouvier, E.; Trivin, F.C.; Rambaud, J. Metabolism of bile salts by alimentary bacteria during transit in the human small intestine. Microb. Ecol. Health Dis. 1995, 8, 151–157. [CrossRef] 107. Nagengast, F.M.; Grubben, M.; van Munster, I. Role of bile acids in colorectal carcinogenesis. Eur. J. Cancer. 1995, 31, 1067–1070. [CrossRef] [PubMed] 108. Salminen, S.; Isolauri, E.; Salminen, E. Clinical uses of probiotics for stabilizing the gut mucosal barrier: Successful strains and future challenges. Antonie van Leeuwenhoek. 1996, 70, 347–358. [CrossRef] [PubMed] 109. European Commission. “Commission Regulation (EC) No 2073/2005 of 15 November 2005 on Microbiological Criteria for Foodstuffs”. Off. J. Eur. Union 2005, L322, 1–19. 110. Silla Santos, M.H. Biogenic amines: Their importance in foods. Int. J. Food Microbiol. 1996, 29, 213–231. [CrossRef] 111. Vidal-Carou, M.C.; Izquierdo-Pulido, M.L.; Martín-Morro, M.C.; Mariné-Font, A. Histamine and tyramine in meat products: Relationship with meat spoilage. Food Chem. 1990, 37, 239–249. [CrossRef] 112. Landete, J.M.; de Las Rivas, B.; Marcobal, A.; Muñoz, R. Molecular methods for the detection of biogenic amine-producing bacteria on foods. Int. J. Food Microbiol. 2007, 117, 258–269. [CrossRef] [PubMed] 113. Biji, K.B.; Ravishankar, C.N.; Venkateswarlu, R.; Mohan, C.O.; Gopal, T.K.S. Biogenic amines in seafood: A review. J. Food Sci. Technol. 2016, 53, 2210–2218. [CrossRef] [PubMed] 114. Uniacke-Lowe, S.; Collins, F.W.J.; Hill, C.; Ross, R.P. Bioactivity screening and genomic analysis reveals deep-sea fish microbiome isolates as sources of novel antimicrobials. Mar Drugs. 2023, 21, 444. [CrossRef] [PubMed] 115. Teber, R.; Asakawa, S. In silico screening of bacteriocin gene clusters within a set of marine Bacillota genomes. Int. J. Mol. Sci. 2024, 25, 2566. [CrossRef] 116. Araújo, C.; Muñoz-Atienza, E.; Ramírez, M.; Poeta, P.; Igrejas, G.; Hernández, P.E.; Herranz, C.; Cintas, L.M. Safety assessment, genetic relatedness and bacteriocin activity of potential probiotic Lactococcus lactis strains from rainbow trout (Oncorhynchus mykiss, Walbaum) and rearing environment. Eur. Food Res. Technol. 2015, 241, 647–662. [CrossRef] 117. Contente, D.; Díaz-Rosales, P.; Feito, J.; Díaz-Formoso, L.; Docando, F.; Simón, R.; Borrero, J.; Hernández, P.E.; Poeta, P.; Muñoz- Atienza, E.; et al. Immunomodulatory effects of bacteriocinogenic and non-bacteriocinogenic Lactococcus cremoris of aquatic origin on rainbow trout (Oncorhynchus mykiss, Walbaum). Front. Immunol. 2023, 14, 1178462. [CrossRef] Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. https://doi.org/10.1016/j.femsre.2004.09.003 https://doi.org/10.3109/08910609509140093 https://doi.org/10.1016/0959-8049(95)00216-6 https://www.ncbi.nlm.nih.gov/pubmed/7576993 https://doi.org/10.1007/BF00395941 https://www.ncbi.nlm.nih.gov/pubmed/8992950 https://doi.org/10.1016/0168-1605(95)00032-1 https://doi.org/10.1016/0308-8146(90)90104-C https://doi.org/10.1016/j.ijfoodmicro.2007.05.001 https://www.ncbi.nlm.nih.gov/pubmed/17532497 https://doi.org/10.1007/s13197-016-2224-x https://www.ncbi.nlm.nih.gov/pubmed/27407186 https://doi.org/10.3390/md21080444 https://www.ncbi.nlm.nih.gov/pubmed/37623725 https://doi.org/10.3390/ijms25052566 https://doi.org/10.1007/s00217-015-2493-z https://doi.org/10.3389/fimmu.2023.1178462 Introduction Materials and Methods Growth Conditions and Isolation of Genomic DNA Whole-Genome Sequencing (WGS), Assembly, and Mapping Bioinformatic (In Silico) Analyses Identification of Bacterial Species Assembly Evaluation, Bacteriocin Identification, and Safety Evaluation Evaluation of the Deconjugation of Bile Salts Evaluation of the Degradation of Mucin Evaluation of the Production of Biogenic Amine Synthesis In Vitro of Bacteriocins and Evaluation of Their Antimicrobial Activity Results WGS, Assembly, and Mapping of S. salivarius MDI13 and L. sakei MEI5 Bioinformatic and Functional Analyses of the Genome of S. salivarius MDI13 and L. sakei MEI5 Species Identification Distribution of Functional Genetic Subsystems Identification of Genetic Determinants Related to Various Probiotic Traits Identification of Antibiotic Resistance Genes and Other Virulence Factors Identification of Mobile Genetic Elements (MGEs) and CRISPR-Cas Systems Identification of Operons Responsible for the Production of Bacteriocins Evaluation of Mucin Degradation, Bile Salt Deconjugation, and Biogenic Amine Production In Vitro Cell-Free Protein Synthesis (IV-CFPS) of Bacteriocins and Evaluation of Their Antimicrobial Activity Discussion Conclusions References