Seasonal comparison of uniform pre-slaughter fasting practices on stress 
response in rainbow trout (Oncorhynchus mykiss)

Andrea Martínez Villalba a,*, Álvaro De la Llave-Propín a,b, Jesús De la Fuente a, Nuria Ruiz c,  
Concepción Pérez d, Elisabet González de Chavarri a, María Teresa Díaz a, Almudena Cabezas a,  
Roberto González-Garoz a, Morris Villarroel b, Rubén Bermejo-Poza a

a Department of Animal Production, Veterinary Complutense University of Madrid, Avenida Puerta de Hierro S/N, 28040 Madrid, Spain
b CEIGRAM-ETSIAAB, Polytechnic University of Madrid, Avenida Complutense 3, 28040 Madrid, Spain
c Department of Cellular Biology, Animal Physiology and Immunology of the Autonomous University of Barcelona, 08193, Cerdanyola del Vallés, Barcelona, Spain
d Department of Animal Physiology, Veterinary Medicine, Complutense University of Madrid, Avenida Puerta de Hierro S/N, 28040 Madrid, Spain

A R T I C L E  I N F O

Keywords:
Rainbow trout
Stress status
Pre-slaughter fasting
Season

A B S T R A C T

Fasting is a common practice in aquaculture, used during fish transport and before slaughter to reduce stress and 
metabolic activity. Research indicates that fasting for 55 to 58 degree days (◦C d) effectively reduces metabolic 
and stress indicators in rainbow trout. Nevertheless, seasonal temperature variations will have an influence over 
fasting length. This study examined the effects of pre-slaughter fasting across different seasons using 495 rainbow 
trout (Oncorhynchus mykiss). Fasting periods of 0, 50, and 100 degree days (◦C d) were tested in both summer 
(22 ◦C) and winter (8 ◦C). Extended fasting resulted in weight loss and lower glucose and triglyceride levels, 
regardless of season. In summer, fasting increased stress response markers such as plasma lactate dehydrogenase 
enzyme and disrupted energy metabolism with increased non-esterified fatty acid levels and lower triglyceride 
levels, while winter fasting showed opposite effects, with trout better adapted to cooler temperatures. Fasting in 
summer minimally impacted skin color but increased chroma levels, like the 100D winter group, which exhibited 
reduced lightness. Liver color remained consistent across summer treatments, indicating reduced liver reserves 
supported by lower liver glycogen levels, comparable to the 100D winter group. Antioxidant systems were more 
active in winter, with higher expression of key genes like superoxide dismutase (sod) and glutathione peroxidase 
(gpx). Meanwhile, heat stress in summer masked the full effects of fasting, highlighting the challenges of fasting 
during warmer months. Overall, fasting had more pronounced effects in winter, where optimal water temper
atures allowed for clearer metabolic adaptations and better energy management. These findings emphasize the 
importance of adjusting fasting protocols to seasonal temperature variations for improved fish welfare and 
management.

1. Introduction

Fasting serves as a widely adopted method in aquaculture used in 
daily handling procedures such as transportation or slaughter. This 
technique involves refraining from feeding fish for a period ranging from 
24 to 48 h to weeks prior to stressful events (Fernández-Muela et al., 
2023; Frohn et al., 2024). It appears to bolster their stress resilience and, 
specifically preceding transport and slaughter, fasting can confer bene
fits to fish by reducing their metabolic rate, lowering the accumulation 
of ammonia and carbon dioxide in the water, maintaining its quality, 
and preventing contamination of carcasses during evisceration 

(Bermejo-Poza et al., 2017; Lines and Spence, 2012; Poli et al., 2005). 
Nonetheless, there are apprehensions regarding the optimal duration of 
fasting, as prolonged periods may potentially compromise fish welfare 
(FAWC (Farmed Animal Welfare Council), 1996, Hvas et al., 2024).

Several prior investigations into fasting durations across diverse fish 
species, with minimal welfare implications, propose a range of 1–5 days 
typically (Lines and Spence, 2012), with Atlantic salmon (Salmo salar) 
showing a maximum fasting tolerance of 72 h (Ashley, 2007) and 
rainbow trout (Oncorhynchus mykiss) enduring fasts of up to 14 days 
(Nikki et al., 2004). However, the European Food Safety Authority ac
knowledges the difficulty in establishing a specific maximum fasting 

* Corresponding author.
E-mail address: amvillalba@ucm.es (A.M. Villalba). 

Contents lists available at ScienceDirect

Aquaculture

journal homepage: www.elsevier.com/locate/aquaculture

https://doi.org/10.1016/j.aquaculture.2024.741750
Received 18 June 2024; Received in revised form 16 September 2024; Accepted 8 October 2024  

Aquaculture 596 (2025) 741750 

Available online 10 October 2024 
0044-8486/© 2024 The Authors. Published by Elsevier B.V. This is an open access article under the CC BY-NC-ND license ( http://creativecommons.org/licenses/by- 
nc-nd/4.0/ ). 

mailto:amvillalba@ucm.es
www.sciencedirect.com/science/journal/00448486
https://www.elsevier.com/locate/aquaculture
https://doi.org/10.1016/j.aquaculture.2024.741750
https://doi.org/10.1016/j.aquaculture.2024.741750
http://crossmark.crossref.org/dialog/?doi=10.1016/j.aquaculture.2024.741750&domain=pdf
http://creativecommons.org/licenses/by-nc-nd/4.0/
http://creativecommons.org/licenses/by-nc-nd/4.0/


duration based solely on time due to its varying impact on animal 
welfare influenced by factors such as water temperature (EFSA (Euro
pean Food Safety Authority), 2008). This complexity stems from fish 
being poikilothermic, lacking internal mechanisms to regulate body 
temperature. Consequently, their physiological response, metabolic 
rates, food intake and oxygen demands adjust according to environ
mental conditions (Noble et al., 2020). These adaptations can influence 
fish metabolism by mobilizing readily available energy reserves, such as 
hepatic glycogen, initiating lipid catabolism, and altering the fatty acid 
profile, which may even be reflected in tissue color. Additionally, the 
rapid release of hormones like catecholamines and cortisol into the 
bloodstream can also impact skin color (Villalba et al., 2023). To address 
this issue, degree days (◦C d) are utilized as a metric to estimate the 
appropriate fasting duration. Numerous studies have delved into 
determining the optimal degree days for rainbow trout to ensure 
adequate digestive emptying while upholding animal welfare (Bermejo- 
Poza et al., 2016; Bermejo-Poza et al., 2017; Bermejo-Poza et al., 2019; 
Fernández-Muela et al., 2023; López-Luna et al., 2013), suggesting that 
metabolic and stress indicators were not significantly different from 
controls in trout fasted from 12 to 55 ◦C d.

Given that degree days signify an aggregation of average daily 
temperatures, fasting at 55–58 ◦C d during summer cannot be equated 
directly with the same duration in winter. This variation emerges due to 
the contrasting average temperatures encountered in each season, 
potentially leading to shorter fasting periods during summer and longer 
ones in winter. Consequently, despite understanding the optimal degree- 
day range for rainbow trout, uncertainty persists regarding whether 
these parameters consistently impact fish welfare across different sea
sons. Several studies have assessed various degree-days regimes in 
rainbow trout under cold water conditions, with values ranging from 55 
to 200 ◦C d (average water temperature of 10.2 ± 1.1 ◦C; Bermejo-Poza 
et al., 2019) 17.2 to 55.3 ◦C d (average of 6.15 ± 0.6 ◦C; Bermejo-Poza 
et al., 2017), 11.5 to 34.1 ◦C d (average of 11.36 ± 0.16 ◦C; López-Luna 
et al., 2016) and 3 to 14 days of starvation (average of 3.8–4.2 ◦C; 
Waagbø et al., 2017). The collective findings of these studies illustrate 
the minor impacts of starvation on stress, health and flesh quality 
markers in determined ◦C d. Furthermore, research conducted under 
warmer temperatures, ranging from 19.5 to 58.0 ◦C d (average of 19.33 
± 0.56 ◦C), suggest that rainbow trout can endure fasting periods of up 
to three days (58.0 ◦C d), compromising notably their welfare once it is 
exceeded. This could be due to their condition of cold water species, 
with optimum temperature in a range of 12 to 18 ◦C (Huang et al., 2018) 
and lethal temperature of 23–25 ◦C (Farrell et al., 1996). Consequently, 
heat stress represents a significant threat to rainbow trout farming, 
especially in the context of global climate change. Increased tempera
tures in aquatic environments can adversely affect critical reproductive 
aspects in male rainbow trout (Butzge et al., 2021), alter the metab
olomic profile in the liver and influence various metabolic pathways, 
immune responses and oxidative stress (Li et al., 2022).

Therefore, López-Luna et al. (2016) addressed this gap by comparing 
fasting durations of 1, 2 or 3 days in two different trials with water 
temperatures of 22.7 or 11.1 ◦C, finding greater stress levels in the trial 
conducted at the warmer water temperatures. Considering the paucity of 
research comparing identical optimal degree-days conditions across 
different seasons, the primary objective of this study was to evaluate the 
stress response in rainbow trout subjected to various degree-days pre- 
slaughter fasting conditions encompassing both summer and winter 
months but for longer fasting durations.

2. Material and methods

2.1. Experimental design

The study took place at the aquaculture facilities of the School of 
Forestry Engineering in Madrid, Spain, spanning both summer (May 
2022) and winter (December 2022) months. Water for the experiment 

was sourced from an underground well, distributed across multiple 
tanks, and then cycled back into the well after passing through a bio
filter, utilizing a recirculating aquaculture system (RAS). The average 
water temperature during the study period was 22.0 ± 0.057 ◦C in 
summer and 8.80 ± 1.790 ◦C in winter. Weekly evaluations of physi
cochemical parameters were recorded for each tank, revealing no sig
nificant discrepancies among them. The average values (mean ± SEM) 
for these parameters were as follows: pH 7.0 ± 0.2; dissolved oxygen: 
8.0 ± 0.3 mg O₂/L; alkalinity: 40.7 ± 14.2 mg/L; un-ionized ammonia 
(NH₃): 0.05 ± 0.01 mg/L; nitrite (NO₂− ): 0.25 ± 0.05 mg/L; nitrate 
(NO₃− ): 34.3 ± 2.51 mg/L. Throughout the entire duration of the trial, 
fish adhered to the natural photoperiod, experiencing 10 h of light and 
14 h of darkness (10 L:14D) during summer and 9 h of light and 15 h of 
darkness (9 L,15D) during winter.

The research procured a total of 495 rainbow trout from a com
mercial farm located in Cifuentes, Guadalajara, Spain, for each experi
ment. Upon their arrival, the trout underwent a standardized two-week 
adaptation period. To ensure batch uniformity based on weight, the fish 
were systematically distributed across 9 tanks, each measuring 1 m × 1 
m × 0.85 m with a water volume of 0.85 m3, aiming to attain similar 
final density levels in each season (17.05 ± 0.051 kg/m3 per tank, n =
55). The fish received daily feedings over a two-week period, with each 
feeding comprising 1.5 % of their body weight with a commercial 
growth feed EFICO YS 887F 3 (BioMas) (42 % crude protein, 23 % fat, 
4.1 % ash, 2.0 % crude fiber, and 30 ppm astaxanthin). These feeding 
protocols adhered strictly to established guidelines for rainbow trout. 
Following this, the fish underwent prescribed pre-slaughter fasting pe
riods, which were determined according to the season.

The tanks were grouped into sets of three per treatment: “0D,” “50D,” 
and “100D.” In the summer experiment, “0D” referred to the non-fasting 
groups, “50D” denoted a 3-day fasting period with an average temper
ature of 65.5 ± 0.22 ◦C d, and “100D” indicated a 6-day fasting period 
with an average temperature of 131.3 ◦C ± 0.07 ◦C d. Conversely, in the 
winter trial, “0D” once again represented the non-fasting group, “50D” 
corresponded to a 6-day fasting period with a mean temperature of 58.7 
± 2.21 ◦C d, while “100D” represented a 13-day fasting period with a 
mean temperature of 114.5 ◦C ± 1.86 ◦C d.

2.2. Sampling

After completing the designated fasting periods for each season, 10 
individuals per tank were captured using nets. Subsequently, they were 
slaughtered using the Ike Jime method, which is a welfare-focused 
approach that minimizes intrusion and preserves meat quality. This 
method entails puncturing the brain of each trout with a sharp tip, fol
lowed by the severing of the head (Salazar-Duque et al., 2019).

To ensure precision and minimize handling duration, individual 
sampling was conducted post-harvest. Subsequently, each fish was 
weighed individually, and a 2 mL blood sample was promptly drawn 
from the caudal vein. The blood sample was then divided into two tubes 
for subsequent analysis: one tube contained sodium fluoride (NaF) for 
glucose and lactate determination, while the other tube contained eth
ylenediaminetetraacetic acid (EDTA) as an anticoagulant for cortisol, 
triglycerides, non-esterified fatty acids (NEFA), lactate dehydrogenase 
enzyme (LDH), creatine phosphokinase (CPK) enzyme analysis, and 
osmolality. Both tubes were centrifuged at 1200 rpm for 10 min to 
obtain plasma, which was subsequently stored at 4 ◦C until further 
analysis. After, the fish underwent evisceration, and a portion of the 
liver was sampled and immediately frozen in liquid nitrogen for subse
quent analysis. This included determining liver glycogen concentration, 
assessing acetylcholinesterase (AChE) activity and RNA extraction.

2.3. Assay procedures

2.3.1. Plasma analysis
We conducted analysis on plasma concentrations of cortisol, glucose, 

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

2 



lactate, triglycerides, NEFA, LDH, and CPK enzymes. Cortisol levels were 
determined utilizing an enzyme immunoassay with a commercial 
Cortisol EIA well kit from Radim Ibérica S.A. (Barcelona, Spain). Glucose 
and lactate concentrations were quantified using enzymatic- 
spectrophotometric methods provided by Spinreact S.A. (Sant Esteve 
de Bas, Spain). Triglyceride levels were assessed through a fully enzy
matic method utilizing a commercial kit from Boehringer Mannheim 
(Barcelona, Spain). NEFA concentrations were determined via an 
enzymatic-colorimetric method using commercial kits obtained from 
Randox Diagnostic (London, UK). LDH activity was evaluated based on 
the method described by Furné et al. (2012), which involves monitoring 
the conversion of pyruvate to lactate by observing the oxidation of 
NADH. CPK levels were measured using a Roche/Hitachi 717 Chemistry 
Analyzer (Roche Diagnostics, S.L., Sant Cugat del Valles, Spain) in 
combination with reagents from Boehringer Mannheim. Osmolality was 
assessed in 20 μL of plasma by measuring the freezing point using an 
osmometer (Fiske one-Ten®, Fiske Co, MA, USA).

2.3.2. Liver glycogen
To determine liver glycogen concentration, liver samples weighing 

0.5 g were homogenized and subsequently diluted with perchloric acid, 
following the technique outlined by Dreiling et al. (1987). In the analysis 
of AChE activity in liver samples, a phosphate buffer pH 8 of 0.1 M was 
employed along with acetylthiocholine iodide at a concentration of 
0.075 M and dithiobisnitrobenzoic acid (DTNB) at a concentration of 
0.01 M as substrates, as described by Ellman et al. (1961). Absorbance 
readings were recorded at 412 nm at intervals of 36 s for a duration of 
three minutes.

2.3.3. Liver and skin color
For color analysis, three measurements were taken from both the 

liver and the dorsal portion of the skin (located on the right-hand side, 
just behind the dorsal fin) of each fish at 0 h post-mortem. A Minolta 
Spectrophotometer CM-2500c (Minolta, Osaka, Japan) was employed 
for these measurements. The color scale chosen was the CIE Lab* system, 
as recommended by the International Commission on Illumination 
(Commission Internationale de l’ Eclairage (CIE), 1978). To quantify the 
color, the a* and b* parameters were utilized. From these parameters, 

the chroma (C* = √ (a*^2 + b*^2)) and hue (h* = arctan(b*/a*) x 57.29) 
values were calculated. These calculations provided insights into the 
intensity (chroma) and perceived color (hue) based on the measured 
color parameters.

2.3.4. Liver gene expression
The RNA extraction of liver was performed using Maxwell RSC 

Simply RNA Tissue (Promega, USA) following the manufacturer’s in
structions. After the RNA isolation a Nanodrop 2000 Spectrophotometer 
(Thermo Fisher Scientific Inc., USA) was used to assess RNA concen
tration and purity (A260/A280 ratio). The cDNA of each sample was 
synthesized from 2 μg of RNA using the iScript cDNA Synthesis kit (Bio- 
Rad, USA) following the manufacturer’s instructions. Gene expression of 
liver tissue was analyzed using real-time quantitative PCR (RT-qPCR) in 
a CFX Touch™ Real-Time PCR Detection System (Bio-Rad, USA), ac
cording to MIQE guidelines (Bustin et al., 2009). Stress genes (gr1, 
hsp70, hsp90, mr), oxidative stress (cat, sod, gpx, gst) and metabolism 
(eno, hif1) and elf1, 18 s and rps16 used as reference genes. Three 
different reference genes were used, as employing more than two en
hances resolution and improves the accuracy of the results (Kozera and 
Rapacz, 2013). All pairs of primers had been previously validated in 
rainbow trout tissues (García-Meilán et al., 2022; Holen et al., 2021; 
Teles et al., 2013) and their sequence, GeneBank accession number, 
efficiency and product size are specified in Table 1. Prior to the analyses, 
a dilution curve with a pool of samples was run to determine the 
appropriate cDNA dilution for each gene, as well as to confirm the 
absence of primer-dimers, and the specificity of the reaction by single 
peak in the melting curve for each primer set. Briefly, all the analyses 
were performed in triplicate wells using 384-well plates with a final 
volume of 5 μL (2.5 μL iTAq™ Universal SYBR® Green Supermix (Bio- 
Rad, USA), 0.250 μM of forward and reverse primers and 1 μL of diluted 
cDNA for each sample). The qPCR program had an initial desaturation 
step of 3 min at 95 ◦C, followed by 40 cycles at 95 ◦C for 10 s and 60 ◦C 
for 30s. The software Bio-Rad CFX Maestro 2.3 was used to calculate, 
and the stability of reference genes were confirmed with the geNorm 
algorithm using Excel. Relative mRNA expression levels were calculated 
using the 2-ΔΔCT method followed by arbitrary normalization to a value 
of 1 for the 0D group.

Table 1 
Sequences of primers used in gene expression analysis and accession numbers.

Gene Official name Accession number Sequence 5′ -3’ Efficiency liver (%) Reference

elf1a Elongation factor 1 NM_ 001124339 FW: TGCCCCTGGACACAGAGATT 104.5 Holen et al., 2021
RV: CCCACACCACCAGCAACAA

rps16 Ribosomal Protein tcbk0005c.o.13_5.1.om.4 FW: TTTCAGGTGGCGAAACATGC 104.9 Marandel et al., 2015
RV: GGGGTCTGCCATTCACCTTG

18 s Ribosomal protein S18 XR_005034822.1
FW: TGAGCAATAACAGGTCTGTG

106.9 García-Meilán et al., 2022RV: GGGCAGGGACTTAATCAA

cat Catalase XM_021568213.2
FW: GCAGTGCCTTTTTGGGTTAGT

96.6 García-Meilán et al., 2022
RV: ACCAAACCACAACTCTTCAGTG

sod2 Superoxide dismutase XM_021612540.2 FW: TCCCTGACCTGACCTACGAC 103.7 García-Meilán et al., 2022
RV: GGCCTCCTCCATTAAACCTC

gpx Glutathione peroxidase XM_021569971.2
FW: ATTCCCCTCCGATGACTCCA

107.9 García-Meilán et al., 2022RV: TGGTCAGGAACCTTCTGCTG

gst Glutathione-S-transferase XM_021561454.2
FW: TATTGTGGGCTAATGTGTAAGAT

101.0 García-Meilán et al., 2022RV: CCCTGAAGAGCTTTGTCG

eno Enolase XM_036988980.1
FW: CAAAGGTGTCTCAAAAGCCG

107.8 García-Meilán et al., 2022
RV: GTTGACGTTCTGCCGTACAA

hif1α Hypoxia-inducible factor 1 alpha NM_001124288.1 FW: TTCTCTGTGCTCTTCTGTGCG 102.1 García-Meilán et al., 2022
RV: TGAGTAAGGAAGCAGGGCAA

gr1 Glucocorticoid receptor 1 Z54210.1
FW: CGCAGCAGAACCAACAGTTG

100.6 Teles et al., 2013RV: ATGAGGGCGTCCAAGTACAGA

mr Mineralocorticoid receptor AF209873.1
FW: GGCAGCGTTTGAGGAGATGA

102.0 Teles et al., 2013RV: CATGGCGTCCAGTAGCTTGG

hsp70 Heat shock protein 70 NM_001124228.1 FW: ATTCTGAACGTAGCAGCGGT 108.0 García-Meilán et al., 2022
RV: GCCATCTTCTCCCTCTGTGC

hsp90 Heat shock protein 90 AB196457 FW: TCCAGCAGCTGAAGGAGTT 99.9 Ings et al., 2011
RV: TGAGCTTGCAGAGGTTCTCA

FW: Forward primer; RV: Reverse primer.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

3 

http://tcbk0005c.o.13_5.1.om


2.4. Statistical analysis

Statistical analysis was conducted using GraphPad Prism 9.0.0.121 
software (GraphPad Software Inc.). Prior to analysis, normality and 
homogeneity of variance were assessed for all variables using the 
Shapiro-Wilk test and Bartlett’s test, respectively. Subsequently, a two- 
way ANOVA was applied, considering as fixed effects: fasting duration 
(0, 50, or 100 ◦C) and seasonality (summer and winter). Post-hoc 
comparisons of means were conducted using the Tukey test, with sig
nificance set at p < 0.05. Pearson r correlations were conducted on 
plasma parameters and liver glycogen and gene expression and dis
played using a double gradient color map to enhance visualization.

3. Results

3.1. Weight and blood/plasma parameters

Slaughter weight presented only significant differences due to pre- 
slaughter fasting (p < 0.001). Fish subjected to 100D fasting exhibited 
a significantly lower slaughter weight compared to the 0D group, both in 
summer and winter (0D: 315.57 ± 38.71 g vs. 100D: 289.72 ± 46 g in 
summer; 0D: 325.72 ± 32.28 g vs. 100D: 303.31 ± 33.56 g in winter).

Blood and plasma parameters are presented in Fig. 1. A significant 
interaction between pre-slaughter fasting and season was observed 
concerning plasma cortisol levels. The 50D fish exhibited higher cortisol 
levels in the winter group compared to summer, while no differences 
were noted between non-fasted and 100D fasted individuals in each 
season. Plasma glucose decreased significantly with fasting (0D: 71.09 
± 12.44 mg/dL vs. 50D: 59.48 ± 9.43 mg/dL vs. 100D: 53.56 ± 5.93 
mg/dL). Lactate in plasma displayed a significant interaction between 
pre-slaughter fasting and season, with both 50D and 100D groups 
showing higher levels in winter than summer, but no significant dif
ferences between seasons in the 0D group. LDH was significantly 
affected by pre-slaughter fasting, with higher concentrations in non- 
fasted and 50D fasted individuals compared to 100D (0D: 1673.05 ±
424.15 UI/L, 50D: 1650.63 ± 602.26 UI/L vs. 100D: 1415.37 ± 301.21 
UI/L), and by season, with lower levels observed in winter than summer 
(1160.45 ± 358.28 UI/L vs. 1998.91 ± 526.80 UI/L). Plasma 

triglyceride levels were also significantly influenced by both fixed fac
tors, with higher concentrations in non-fasted fish than the other groups 
(0D: 153.08 ± 38.24 mg/dL vs. 50D: 133.99 ± 29.21 mg/dL vs. 100D: 
130.99 ± 32.74 mg/dL) and higher levels in winter than summer 
(161.82 ± 34.32 mg/dL vs. 116.89 ± 32.47 mg/dL). Regarding NEFA, a 
significant interaction between pre-slaughter fasting and season was 
observed, with no differences between seasons in the 0D and 100D 
groups, but 50D fish showed lower NEFA plasma levels in winter than 
summer. CPK enzyme plasma levels also displayed a significant inter
action between pre-slaughter fasting and season effects, being higher in 
summer in both non-fasted and 50D fasted individuals, but similar be
tween seasons in the 100D group. Plasma osmolality was significantly 
affected by season, with lower values in summer than winter (313.5 ±
7.53 mOsm/kg vs. 372.1 ± 33.82 mOsm/kg).

3.2. Skin color

The skin color data are summarized in Table 1. The interaction be
tween pre-slaughter fasting and season showed a significant impact on 
all color parameters examined in the skin, except for h*. L* was notably 
lower in winter than in summer for 100D fish, while the other groups 
showed no significant differences between seasons. For 0D fish, the a* 
value was higher in summer than in winter, with no significant differ
ences observed between seasons for the other groups. Similarly, b* and 
C* values were comparable between seasons in the 100D group, but 
significantly lower in winter than in summer for 0D and 50D fish. The 
hue value was significantly influenced by pre-slaughter fasting, with 0D 
and 50D groups showing the highest and lowest levels, respectively (0D: 
65.30 ± 15.35 vs. 50D: 54.33 ± 19.8 vs. 100D: 61.53 ± 18.70).

3.3. Liver color and glycogen

The liver color parameters and liver glycogen concentration data are 
summarized in Table 2. Concerning liver color parameters, L* and a* 
values were significantly influenced by season, displaying higher values 
during winter for L* (37.26 ± 5.68 vs. 26 ± 2.06) and during summer 
for a* (10.08 ± 2.00 vs. 8.88 ± 2.59). The remaining color parameters 
(b*, C*, and h*) exhibited a significant interaction between pre- 

Fig. 1. Plasma biochemical parameters of rainbow trout with different pre-slaughter fasting periods and seasons. Data are presented as mean ± SEM (n = 30). 0D: 
non-fasted; 50D: 65.5 ± 0.22 ◦C d of fasting in summer (3 days) and 58.7 ± 2.21 ◦C d of fasting in winter (6 days); 100D: 131.3 ± 0.07 ◦C d of fasting in summer (6 
days) and 114.5 ± 1.86 ◦C d of fasting in winter (13 days); LDH: lactate dehydrogenase enzyme; NEFA: non esterified fatty acids; CPK: creatine phosphokinase 
enzyme; Se: season; F: pre-slaughter fasting. a, b, c Different letters indicate significant differences between groups (p < 0.05). * Indicate significant differences due to 
season (p < 0.05).

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

4 



slaughter fasting and season. The variables b* and h* showed higher 
values in 100D during winter, whereas within the summer season, no 
differences were observed between fasting groups for either parameter. 
This trend was also observed in C*. However, higher values in the C* 
parameter were noted in both 50D and 100D during winter. (See 
Table 3.)

The liver glycogen concentration was significantly affected by the 
interaction between pre-slaughter fasting and season, with the highest 
concentration observed in the 0D winter group. Both the 0D and 50D 
fish exhibited higher liver glycogen concentrations in winter compared 
to the summer season, while the 100D group showed similar levels be
tween seasons.

3.4. Acetylcholinesterase activity

The activity of AChE in liver tissue showed no significant effects 
attributed to pre-slaughter fasting or season. (Fig. 2).

3.5. Liver gene expression

Fig. 3. illustrates genetic expression of liver tissue. All studied liver 
genes’ expressions exhibited a significant interaction between pre- 
slaughter fasting and season, with the exception of mr, which did not 
show significant differences due to either of the fixed effects. In the 50D 
fish, the expression of catalase and enolase was higher in winter than in 
summer, with other groups showing similar values between seasons. 
Among 0D fish, the expression of gst in the liver was lower during winter 
than summer, while no significant differences were observed between 
seasons in the 50D and 100D groups. Sod liver expression was higher in 
0D during summer compared to winter, but lower in 50D during winter 
compared to summer. However, no significant differences between 
seasons were found in the 100D group. 0D fish exhibited higher gpx 
expression in the liver than 100D during summer, with no significant 
differences in winter. Liver gr1 expression was higher in 50D fish during 
winter than in 0D and 100D fish, while during summer all groups 
showed similar expression of this gene. hif1 expression in the liver was 

significantly higher during winter than both summer and winter ex
pressions in 100D fish. 50D fish displayed significantly higher liver 
expression of the hsp70 gene during winter than in summer, while other 
groups showed no significant differences between seasons. During 
winter, 100D fish exhibited higher liver expression of hsp90 than the 
other groups, but no significant differences were found in summer 
among the different pre-slaughter periods.

3.6. Correlation analysis

The data revealed numerous significant correlations between plasma 
parameters and liver glycogen and gene expression (Fig. 4). Cortisol 
exhibited a negative correlation with liver glycogen, as well as with gpx, 
gst, and sod. Plasma glucose was positively correlated with liver 
glycogen but showed negative correlations with liver catalase, enolase, 
gpx, gr1, gst, and sod. Plasma lactate was positively correlated with liver 
sod, while TGC displayed positive correlations with liver glycogen, gpx, 
and gst. Negative correlations were found between NEFA and liver 

Table 2 
Skin color parameters of rainbow trout with different pre-slaughter fasting periods and seasons.

0D 50D 100D p value

S W S W S W Se F Se x F

L* 41.02 ± 7.27a 41.60 ± 9.00a 41.91 ± 1.07 a 42.04 ± 7.83 a 41.96 ± 0.96 a 36.06 ± 5.45 b 0.143 0.10 0.045
a* 3.63 ± 1.26a 1.70 ± 1.93b 3.42 ± 1.14a 2.37 ± 1.57a 2.68 ± 1.47a 2.94 ± 1.99a <0.001 0.76 0.002
b* 7.40 ± 2.74a 3.76 ± 3.07b 7.28 ± 3.27a 2.48 ± 2.46b 6.91 ± 3.03a 5.38 ± 2.92a <0.001 0.07 0.011
C* 9.05 ± 2.01a 5.26 ± 2.36bc 8.54 ± 2.14a 4.42 ± 1.45c 7.42 ± 2.09a 6.70 ± 2.53ab <0.001 0.21 <0.001
h* (◦) 64.48 ± 17.10 66.13 ± 13.60 59.97 ± 18.17 48.70 ± 21.43 63.13 ± 18.26 59.94 ± 19.15 0.123 0.005 0.161

Data are presented as mean ± SEM (n = 30). L* (lightness); a* (redness); b* (yellowness); C* (chroma) = √ (a*2 + b*2); h* (hue) = arctan (b*/ a*) × 57.29. 0D: non- 
fasted; 50D: 65.5 ± 0.22 ◦C d of fasting in summer (3 days) and 58.7 ± 2.21 ◦C d of fasting in winter (6 days); 100D: 131.3 ± 0.07 ◦C d of fasting in summer (6 days) and 
114.5 ± 1.86 ◦C d of fasting in winter (13 days); S: summer; W: winter; Se: season; F: pre-slaughter fasting. a, b, c Different letters indicate significant differences 
between groups (p < 0.05).

Table 3 
Liver color parameters and glycogen concentration of rainbow trout with different pre-slaughter fasting periods and seasons.

0D 50D 100D p value

S W S W S W Se F Se x F

L* 26.79 ± 2.04 38.04 ± 7.52 25.19 ± 2.04 37.45 ± 7.72 26.02 ± 2.10 36.27 ± 1.80 <0.001 0.314 0.540
a* 9.91 ± 1.96 8.33 ± 2.37 10.12 ± 2.19 9.50 ± 3.48 10.22 ± 1.85 8.81 ± 1.92 0.001 0.289 0.514
b* 3.82 ± 1.65d 5.96 ± 2.15c 3.48 ± 1.50d 7.45 ± 1.99b 4.54 ± 1.58d 9.24 ± 2.16a <0.001 <0.001 <0.001
C* 10.98 ± 2.12ab 10.25 ± 3.06b 10.83 ± 2.59ab 12.41 ± 3.08a 11.48 ± 1.84ab 12.83 ± 2.71a 0.066 0.006 0.034
h* (◦) 22.75 ± 8.00c 37.68 ± 9.70b 18.36 ± 5.72c 40.80 ± 14.25b 22.89 ± 7.68c 46.25 ± 4.10a <0.001 0.004 0.021
Gly (mg/g) 55.50 ± 30.34c 186.97 ± 76.53a 28.74 ± 17.33c 114.17 ± 52.49b 29.33 ± 12.81c 59.83 ± 25.96c <0.001 <0.001 <0.001

Data are presented as mean ± SEM (n = 30). L* (lightness); a* (redness); b* (yellowness); C* (chroma) = √ (a*2 + b*2); h* (hue) = arctan (b*/ a*) × 57.29. 0D: non- 
fasted; 50D: 65.5 ± 0.22 ◦C d of fasting in summer (3 days) and 58.7 ± 2.21 ◦C d of fasting in winter (6 days); 100D: 131.3 ± 0.07 ◦C d of fasting in summer (6 days) and 
114.5 ± 1.86 ◦C d of fasting in winter (13 days); S: summer; W: winter; Se: season; F: pre-slaughter fasting. a, b, c, d Different letters indicate significant differences 
between groups (p < 0.05).

Fig. 2. Acetylcholinesterase (AChE) enzyme activity of rainbow trout with 
different pre-slaughter fasting periods and seasons. Data are presented as mean 
± SEM (n = 30). 0D: non-fasted; 50D: 65.5 ± 0.22 ◦C d of fasting in summer (3 
days) and 58.7 ± 2.21 ◦C d of fasting in winter (6 days); 100D: 131.3 ± 0.07 ◦C 
d of fasting in summer (6 days) and 114.5 ± 1.86 ◦C d of fasting in winter (13 
days); Se: season; F: pre-slaughter fasting.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

5 



glycogen, and between LDH/CPK and both liver glycogen and gpx. 
Additionally, osmolality was positively correlated with liver glycogen 
and all liver genes except hsp70.

4. Discussion

4.1. Fish growth

Starvation leads to a noticeable reduction in weight, a consistent 
observation across studies involving various fish species (Einen et al., 
1998; Guderley et al., 2003; Luo et al., 2006; Luo et al., 2009; Regost 
et al., 2001). Specifically, the slaughter weight begins to decrease in 
rainbow trout following fasting periods ranging from 1 to 6 weeks 
(Pottinger et al., 2003; Bermejo-Poza et al., 2019; Sumpter et al., 1991). 
This is in line with the current study, where both pre-slaughter fasting 
groups exhibited lower weight compared to non-fasting individuals, 
being more pronounced in the 100D group. The 50D fasting group aligns 
with Einen et al. (1998), who observed significant weight differences 
after only 3 days of food deprivation, equivalent to 13.5 ◦C days in other 
species, such as salmon. Additionally, some authors suggest that short- 

term fasting before any stressful procedure, such as handling, trans
port or slaughter, may enhance fish stress tolerance, reducing stress 
response during these procedures in aquaculture production (Davis and 
Gaylord, 2011), requiring shorter fasting at higher temperatures (Robb, 
2008). This could be attributed to physiological changes during non- 
feeding periods, enabling the utilization of stored energy reserves for 
metabolic maintenance (Bermejo-Poza et al., 2019; Navarro and 
Gutiérrez, 1995), leading to a drastically reduced weight due to energy 
expenditure. This was demonstrated in salmon, while metabolism de
creases with lower water temperature (Beck and Gropp, 1995; Cho and 
Bureau, 1995). However, in this study, no interaction between fasting 
and seasonality was observed.

4.2. Blood parameters

The absence of food can trigger a range of physiological responses 
collectively known as the stress response. This response is an adaptive 
mechanism aimed at maintaining homeostasis. It begins with a cascade 
of events initiated by the stressor, starting with neuroendocrine re
sponses in fish. These primary responses involve the rapid release of 

Fig. 3. Genetic expression in liver tissue of rainbow trout with different pre-slaughter fasting periods and seasons. Data are presented as mean ± SEM (n = 30). 0D: 
non-fasted; 50D: 65.5 ± 0.22 ◦C d of fasting in summer (3 days) and 58.7 ± 2.21 ◦C d of fasting in winter (6 days); 100D: 131.3 ± 0.07 ◦C d of fasting in summer (6 
days) and 114.5 ± 1.86 ◦C d of fasting in winter (13 days); gst: glutathione transferase; sod: superoxide dismutase; gpx: glutathione peroxidase; gr1: glucocorticoid 
receptor 1; mr: mineralocorticoid receptor; hif1: hypoxia inducing factor; hsp70: heat shock protein 70; hsp90: heat shock protein 90; Se: season; F: pre-slaughter 
fasting. a, b, c Different letters indicate significant differences between groups (p < 0.05).

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

6 



hormones such as catecholamines and cortisol into the bloodstream 
(Belanger et al., 2001).

. Cortisol, a widely recognized stress indicator, is consistently re
ported to be elevated in response to fasting in mammals (Ortiz et al., 
2001). In the present study, higher cortisol levels were observed in the 
50D group compared to non-fasting only during winter, consistent with 
findings in other studies (Barcellos et al., 2010; Barton et al., 1988; 
Sadoul and Geffroy, 2019). However, evidence in fish is contradictory, 
as cortisol levels can also decrease to lower levels (Farbridge and 
Leatherland, 1992; Small, 2005) or remain similar to those of fed in
dividuals (Weber and Bosworth, 2005), as observed here between the 
100D and 0D groups, regardless of the season. When focusing on fasting, 
the reason why the 50D group exhibited higher cortisol levels than the 
0D group in winter could be linked to the heightened stress of tran
sitioning from ample access to food every day to none, potentially 
leading to increased social stress (Jeffrey et al., 2014). This is consistent 
with other research, indicating that trout subjected to 3–4 days of fasting 
showed higher cortisol levels than control groups (Bermejo-Poza et al., 
2019) and feed-deprived cod (Gadus morhua) displayed increased and 
prolonged responsiveness to stress compared to fed cod (Hultmann 
et al., 2012; Olsen et al., 2008). The lack of change between the 100D 
and 0D groups in both seasons could result from the prior feeding regime 
inducing chronic stress, which has been reported to diminish the cortisol 
response, suggesting a lower stress response, possibly because trout 
were already adapted to this regimen and reduced their metabolic rate, 

as observed in individuals undergoing longer fasting periods of around 
6–9 days (Bermejo-Poza et al., 2019; Farbridge and Leatherland, 1992; 
Hultmann et al., 2012; Lines and Spence, 2012; Olsen et al., 2008; 
Pottinger et al., 2003; Sumpter et al., 1991). However, this contradicts 
findings by Blom et al. (2000), who found higher cortisol levels after 
three weeks of starvation. It should also be noted that cortisol secretion 
can return to basal values within a few days (Ellis et al., 2012), possibly 
due to depletion of the hypothalamic–pituitary–interrenal (HPI) axis, so 
the lack of changes could be masked after 5 days of fasting (Bermejo- 
Poza et al., 2019), a phenomenon also observed by Woo and Fung 
(1981) in sea bream after 7 days of starvation. The truly intriguing 
aspect is the lack of variance between fasting groups during the summer 
season. Cortisol levels typically vary with temperature, among other 
factors (Pottinger, 2010), with higher concentrations often released at 
22.7 ◦C compared to 11.1 ◦C (Arends et al., 1998; Kuhn et al., 1986; 
Pottinger, 1998), which is closer to rainbow trout’s optimal water 
temperature (12–18 ◦C) (Huang et al., 2018). However, in this trial, 
higher levels were found in the 50D group during winter (58.7 ◦C days, 
corresponding to 9 ◦C per day over 6 days) compared to the 50D group 
during summer (65.49 ◦C days, equivalent to 22 ◦C per day over 3 days), 
which also contradicts the findings of López-Luna et al., 2013, who 
observed an adjustment to short-term fasting at 58.9 ◦C days. This 
discrepancy could be attributed to the fact that they are allocating 
attention to other mechanisms to combat thermal stress, resulting in 
limited physiological variations when exposed to another stressor (Zhou 

Fig. 4. Heatmap of Pearson’s correlations between plasma parameters and liver glycogen and gene expression (number inside the box corresponds to the r value for 
the correlations). * p < 0.05. TGC: Plasma triglycerides; LDH: lactate dehydrogenase enzyme; CPK: creatine phosphokinase enzyme; gpx: glutathione peroxidase; gr1: 
glucocorticoid receptor 1; gst: glutathione transferase; hif1: hypoxia inducing factor; hsp70: heat shock protein 70; hsp90: heat shock protein 90; mr: mineralocorticoid 
receptor; sod: superoxide dismutase.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

7 



et al., 2022).
Basal glucose levels are typically estimated to be in the range of 

70–90 mg/dL (Jentoft et al., 2005), which aligns with our findings in the 
0D individuals (70.50 ± 10.86 mg/dL in summer vs. 71.69 ± 14.04 mg/ 
dL in winter). However, in this trial, a decline in glucose levels can be 
observed across fasting groups without any difference between seasons, 
unlike Jiang et al. (2021), who reported a decrease in plasma glucose 
levels with temperature in rainbow trout. Decline started at 65.49 ◦C 
days (50D in summer) and 58.7 ◦C days (50D in winter), consistent with 
the findings of Furné et al. (2012), where periods of food deprivation 
around 70 ◦C days induced hypoglycemia in rainbow trout as well. This 
could be attributed to the mobilization of body reserves, as carbohy
drates are the primary and earliest source of energy when fish are 
deprived of food (Davis and Gaylord, 2011), reinforced by the positive 
correlation observed between glucose and liver glycogen in our results. 
These lower plasma glucose levels did not return to basal levels, being 
lower at 100D in both seasons, possibly due to an adaptive mechanism 
depressing basal metabolism to adapt to energy restriction and maintain 
vital functions during long-term fasting (Karatas et al., 2021).

Although lactate is considered an acute stress indicator in fishes due 
to its increase under adverse situations, it can also be influenced by 
fasting (Grutter and Pankhurst, 2000; Thomas et al., 1999). It is ex
pected to decrease in fasted fish (Blasco et al., 1992) to enhance hepatic 
gluconeogenesis (Liew et al., 2012), as observed in fasted rainbow trout 
for 200 ◦C d and other fasted fish (Bermejo-Poza et al., 2019; Sangiao- 
Alvarellos et al., 2005; Soengas et al., 1996). This may explain the 
tendency for a decrease during the summer season in each fasting group 
(50D and 100D). However, the winter season did not affect lactate 
mobilization, keeping it stable and higher than in summer, possibly due 
to adaptation facilitated by favorable temperatures for them. The notion 
that summer induces a greater stress response than winter is also evident 
in LDH, as higher activity was observed. LDH activity is linked to glucose 
anaerobic oxidation and is utilized as a biomarker for heat stress in fish 
(Feidantsis et al., 2015). Moreover, elevated activity of this enzyme can 
indicate hepatic, renal or muscular damage, which may be related to 
stress stimuli such as fasting (Peres et al., 2014). Therefore, the winter 
season appears to elicit a lesser stress response. Conversely, 0D and 50D 
groups in both seasons seemed to exhibit insignificant differences, 
possibly because it necessitates more degree days of fasting, as observed 
in Bermejo-Poza et al. (2019).

In terms of body reserve mobilization, fasting induces a sequential 
utilization of lipids, reflected in reduced plasma triglyceride levels 
(Karatas et al., 2021). Triglycerides also serve as a significant energy 
source that fish utilize in response to stressful stimuli such as acclima
tization to different growth densities or fasting (Laiz-Carrión et al., 
2012; Millán-Cubillo et al., 2016), supported by the correlations 
observed with liver glycogen, gpx and gst in our study. Similar to glucose, 
plasma triglyceride levels decreased after 3 days of fasting in summer 
(65.49 ◦C d; 50D) and after 6 days in winter (58.7 ◦C days; 50D), 
possibly due to insufficient glycogenolysis to normalize glucose levels 
(Favero et al., 2018). In other studies, rainbow trout required 10 days 
(107 ◦C d) to exhibit similar results and fasting periods were even 
extended to 120 days (approximately 1104 ◦C d) (Bermejo-Poza et al., 
2019; Karatas et al., 2021). However, triglyceride levels in the 100D 
group appeared to be similarly low as in the 50D group, regardless of 
seasonality, possibly indicating the initiation of lipid reserve mobiliza
tion from muscle and adipose tissue (Li et al., 2011), as reflected in 
NEFA concentration. Lipolysis was confirmed by the elevated levels of 
NEFA after 3 and 6 days of fasting (50D), remaining high up to 6 and 13 
days (100D) (Bermejo-Poza et al., 2019; Mancera et al., 2008; Polakof 
et al., 2006). Additionally, the higher concentration of triglycerides in 
winter compared to summer could be attributed to apparently reduced 
activity and diminished energy mobilization, since fish under environ
mental stress require higher energy demand obtained from triglycerides, 
as found Jiang et al. (2021) at 21 ◦C.

The reduction in CPK levels observed during starvation, noted after 

6 days (131.3 ◦C d; 100D summer), has also been documented in other 
fish species such as sea bream (Peres et al., 2013) and rainbow trout after 
9 days (55.3 ◦C days) (Bermejo-Poza et al., 2017). However, this decline 
was evident only during the summer season, whereas CPK concentration 
remained stable across all fasting groups during winter. The decrease in 
CPK activity is attributed to reduced enzyme synthesis and turnover 
rates due to lower metabolic demands in unfed fish (Echevarría et al., 
1997; Evans and Watterson, 2009). The diminished levels observed 
during winter in the 0D and 50D groups could be attributed to a possible 
reduction in energy demands. Osmolality plays a pivotal role in the 
physiological mechanisms of fish, particularly in their capacity to up
hold internal equilibrium amidst fluctuating environmental osmotic 
challenges (Kirsch et al., 1984). We can confirm the important role of 
osmolality due to its strong relationship with other parameters 
measured in this study, supported by the large number of positive cor
relations it showed with liver glycogen and almost all the genes 
measured in the liver. While data regarding the impact of fasting on 
plasma osmolality in fish are limited, observations from other re
searchers (Umminger, 1971) suggest that inorganic electrolytes increase 
as temperature is lowered, leading to higher osmolality in colder envi
ronments. This could elucidate the higher osmolality observed in winter.

4.3. Skin color

The pigmentation pattern of the skin is a species-specific trait 
determined by the quantity and arrangement of various types of chro
matophores (Vissio et al., 2021). Rainbow trout, in particular, exhibit a 
distinctive skin color pattern that sets them apart from other salmonids 
(Ade, 1989). This characteristic can undergo changes throughout the 
lifespan of the fish, such as during metamorphosis, the reproductive 
cycle or in response to environmental factors like nutrition, UV expo
sure, ambient light conditions, social interactions and stress (Vissio 
et al., 2021). Stress can play a significant role in altering skin color, as 
stressed fish may experience changes in their natural pigmentation due 
to negative conditions (Iger et al., 2001; Lim et al., 2018). Therefore, the 
skin pigmentation pattern holds promise as an indicator of animal 
welfare in aquaculture species (Pavlidis et al., 2006).

In this study, summer color patterns showed no significant differ
ences among fasting groups, which is consistent with the stable plasma 
cortisol levels observed. This suggests a potential regulatory mechanism 
focusing on higher temperatures as a primary stressor, leading to min
imal color variation despite additional stressors. Additionally, higher 
chroma levels were noted in summer compared to winter, with similar 
levels observed in the 100D group across both seasons. Elevated chroma 
levels are associated with stress (Erikson and Misimi, 2008), reinforcing 
the idea that fasting durations in summer should not exceed 50 ◦C d, as 
stress levels appear elevated even at 0 ◦C d without additional stressors. 
In contrast, winter color parameters varied notably among fasting 
groups. Specifically, the lightness (L*) was lower in the 100D group, 
resulting in darker skin. This finding aligns with Bermejo-Poza et al. 
(2017), who also reported decreased L* in their longest fasting group 
under different temperature conditions. The darkening of the skin could 
be linked to stress-induced effects, such as ACTH’s dispersing effect on 
chromatophores, as seen in Arctic char (Salvelinus alpinus) (Höglund 
et al., 2000), salmon (Salmo salar) (O’Connor et al., 1999), and rainbow 
trout (Oncorhynchus mykiss) (Villalba et al., 2023). This suggests that fish 
experienced significant stress after 10 days of fasting, indicating that 
fasting durations below 100 ◦C d during winter might be advisable to 
avoid chronic stress. Additionally, other color parameters, such as the 
red index (a*), were higher in the 50D and 100D groups, and the yellow 
index (b*) was elevated in the 100D group, indicating a more pro
nounced yellow-reddish coloration in these individuals.

4.4. Liver color and glycogen

Examining the liver color in fasted fish provides valuable insights 

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

8 



into their health and welfare. Research studies have demonstrated that 
liver color can serve as a potential indicator for changes in both lipid 
content and carotenoid pigments, reflecting the dietary composition and 
nutritional status of the fish (Eliasen et al., 2020).

Following a similar trend to skin color, while the winter season 
displayed variations in nearly every color parameter among treatment 
groups, the summer season once again showed no significant differences 
among them, aligning with previous research that also found no 
distinction between fasted trout experiencing temperatures from 17.2 to 
55.2 ◦C day, albeit only in specific color parameters like L* and C* 
(Bermejo-Poza et al., 2017). Lightness (L*) and red index (a*) appeared 
unaffected by fasting but were notably influenced by seasonality. 
Moreover, C* and h* parameters were greater in winter. Consequently, 
liver coloration ranged from light greenish-yellow with a high hue in 
winter to dark bluish-red with less hue in summer. These color alter
ations are typically attributed to hepatic reserve mobilizations and 
stress-induced responses to fasting, resulting in changes in lipid 
composition (Bermejo-Poza et al., 2019; Villalba et al., 2023). There
fore, evaluating liver color facilitates the monitoring of metabolic re
sponses to fasting in fish and, consequently, their welfare status. Given 
that the optimal temperatures for rainbow trout significantly differ from 
those experienced during summer, it is conceivable that they have 
intensified the mobilization of liver reserves as an energy source against 
temperature stress. This reduction in liver reserves, as evidenced by liver 
glycogen data in summer, could be associated with a darker liver color 
characterized by low L*, h*, and high a*. The present observation aligns 
with previous findings in fasted rainbow trout (Bermejo-Poza et al., 
2019), exercised trout (Villalba et al., 2023) and other animals such as 
fasted broiler chickens (Trampel et al., 2005). Focusing on winter 
changes among treatment groups, after 6 days of fasting, liver chroma 
increased in the current study, possibly indicating a decrease in lipid 
concentration, as observed in the trial conducted by Bermejo-Poza et al., 
2019, in 5-day fasting trout.

Liver glycogen levels were found to be lower in summer compared to 
winter, even in non-fasted groups. Notably, in winter, glycogen levels 
decreased significantly with longer fasting durations. The group sub
jected to the longest fasting period in winter (100 ◦C d), which had the 
lowest glycogen concentration, showed levels similar to those of both 
non-fasted and fasted individuals in summer. This suggests that stress 
and food deprivation induce hepatic gluconeogenesis through glyco
genolysis to maintain blood glucose levels (Sangiao-Alvarellos et al., 
2005). The increased mobilization demand during summer highlights 
the elevated energy needs of trout at higher temperatures, correspond
ing to a higher metabolic rate (Jiang et al., 2021). Since no differences 
were observed between the non-fasted group and the 100 ◦C d group, it 
may be necessary to limit fasting durations during summer to no more 
than 50 ◦C d.

4.5. Liver gene expression

Fish can adapt to starvation through the regulation of lipid meta
bolism, particularly in the liver. In this context, fatty acids derived from 
triglyceride hydrolysis are preferentially utilized as fuel through their 
corresponding oxidative pathways (Ensminger et al., 2021; Morales 
et al., 2004). Consequently, fasting has been noted to have pro-oxidant 
effects, as it generates lipoperoxides as a source of reactive oxygen 
species (ROS) through the univalent reduction of O2-. If not adequately 
neutralized, these ROS can lead to cellular oxidative stress (Feng et al., 
2011; Morales et al., 2004; Vranković et al., 2021; Yang et al., 2019). 
However, fish possess effective mechanisms to manage oxidative stress 
situations through antioxidant systems (Ensminger et al., 2021; Morales 
et al., 2004). It is well established that these antioxidant systems typi
cally consist of non-enzymatic and enzymatic components, including 
superoxide dismutase (sod), responsible for detoxifying superoxide an
ions, catalase (cat), which mitigates H2O2, glutathione peroxidase (gpx), 
involved in the reduction of both H2O2 and organic peroxides through a 

glutathione-dependent reaction and glutathione transferase (gst), facil
itating excretion through conjugation with toxic compounds (Bu et al., 
2021; Feng et al., 2011; Karatas et al., 2021; Morales et al., 2004; Yang 
et al., 2019). In this scenario, extended periods of starvation typically 
result in oxidative stress, as observed in Dentex dentex (Morales et al., 
2004), Yangtze sturgeon (Yang et al., 2019) and in our trial, specifically in 
CAT regardless of season, which leads to the enhancement and activa
tion of the antioxidant system. Despite our findings has reveal elevated 
levels of any enzymatic antioxidant in fasted group compared to the 
nonfasted, intriguing variations appear to exist depending on the 
seasonality.

Despite the need to mobilize antioxidant components during fasting, 
it is striking that summer did not show any variation in gst, sod, and gpx 
levels compared to the control, as observed by Florescu et al. (2021) and 
Sánchez-Moya et al. (2022). This apparent stabilization in enzymatic 
antioxidant activity among fasting individuals is likely due to metabolic 
adaptations, which translate into biochemical adjustments that help fish 
conserve energy and prioritize essential metabolic functions for survival 
over antioxidant enzyme production (Ensminger et al., 2021; Zhang 
et al., 2007), particularly given the potential stress of high temperatures. 
It is possible that warm temperatures influence antioxidant responses 
independently of fasting status (Hassan et al., 2020). Additionally, this 
lack of variation in activity during summer contrasts with winter ob
servations, suggesting that both fasting and temperature affect liver 
enzymatic antioxidant activity, possibly by influencing metabolic rate, 
enzymatic reactions, and oxygen uptake (Fonseca et al., 2011).

. During winter, the 0D group exhibited lower values compared to 
both fasted groups in sod, gpx and only with 100D group in cat and gst, 
corroborating the hypothesis that an increase of fasting durations is 
associated with a corresponding rise in antioxidant activity. This notable 
increase in antioxidant activity between non-fasted and fasted in
dividuals in gst and sod has been consistently observed in Dentex dentex, 
Sparus aurata and Yangtze sturgeon (Morales et al., 2004; Pascual et al., 
2003; Yang et al., 2019), suggesting an escalation in ROS generation rate 
leading to enhanced antioxidant activity (Bu et al., 2021). Moreover, the 
decline antioxidant activity observed in sod among fasted individuals, 
for a possible metabolic adaptation, was also noted in S. aurata (Pascual 
et al., 2003) and on the same species (Oncorhynchus mykiss), where this 
reduction during prolonged food deprivation occurred in gst and gpx 
activity (Salem et al., 2007).

During winter, there was a significant increase in enolase activity 
observed in the 50D group, potentially indicating an enhancement in 
energy production through the upregulation of glycolysis-related genes, 
facilitating the mobilization of energy reserves via glycolysis (Li et al., 
2020; Ntantali et al., 2023). Conversely, individuals undergoing pro
longed food deprivation (100D) experienced a really low decrease in 
these values, likely due to an initiation of metabolic adjustments aimed 
at conserving energy and sustaining vital physiological functions (Yang 
et al., 2019). Nevertheless, one more time summer season did not show 
any difference between treatments. Considering the potential heat stress 
analyzed across various parameters, summer temperatures may have 
influenced enzyme activity and energy metabolism, as also observed by 
Li et al. (2022) in rainbow trout. While some studies have reported an 
increase in activity (Liu et al., 2023), elevated temperatures can 
generally disrupt normal functions, leading to fluctuations in enzyme 
activity, including enolase. This could explain why our values were 
unaffected by fasting in summer. A similar scenario unfolded with 
hypoxia-inducing factor (hif1), which plays a pivotal role as a regulator 
of metabolism, particularly in oxygen availability and energy homeo
stasis (Gaspar and Velloso, 2018; Soñanez-Organis et al., 2013). Despite 
high water temperatures typically being associated with low levels of 
dissolved oxygen, which can trigger hif1 activation (Soimato et al., 
2001; Wang et al., 2023), the summer season did not exhibit higher 
values compared to winter, nor did it show differences between fasting 
groups. However, during the winter season, a notable increase was 
observed only in the 50D group, possibly indicating an upregulation of 

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

9 



genes involved in energy metabolism, adapting to the stress situation in 
100D by reducing metabolic rate. This aligns with the findings of 
Soñanez-Organis et al. (2013), who noted a metabolic adaptation during 
fasting through hif2α serotype activation in elephant seals. Although no 
studies have specifically explored the ramifications of fasting in hypoxic 
conditions, numerous investigations have linked hypoxia to reduced 
feed consumption, suggesting that the oxygen demand of fish varies 
according to feeding activity, with energetic expenditures post-feeding 
(Von Herbing and White, 2002; Wang et al., 2023).

Stress receptors inducers (gr1 and mr) exhibited similarities with 
plasma cortisol levels in individuals during summer. As demonstrated by 
Vallejos-Vidal et al. (2022), cortisol binding to gr1 showed no significant 
differences between groups. This observation is consistent with Pot
tinger et al. (2003), who found similar results for plasma cortisol. These 
findings suggest that levels of gr1 and mr may remain unchanged due to 
the interaction between cortisol and its glucocorticoid and mineralo
corticoid receptors. Nevertheless, whereas plasma cortisol reached 
higher values in the 50D winter group, gr1 showed a gradual increase as 
fasting time increased, being much more minimal in mr. Elevated 
cortisol levels have been found to inhibit stress-induced tissue levels of 
heat shock proteins (HSPs), which are activated in response to various 
physical or chemical stressors, particularly heat stress (Beg et al., 2010; 
Werner et al., 2006). Studies have demonstrated that the expression of 
hsp70 and hsp90 in hepatocytes of rainbow trout (Oncorhynchus mykiss) 
(Vijayan et al., 2003), as well as hsp30 in the gills of cutthroat trout 
(O. clarki clarki) (Ackerman et al., 2000), decreases due to cortisol- 
mediated downregulation of their receptors (Basu et al., 2001). This 
indicates a connection between cellular and neuroendocrine stress re
sponses in fish during periods of physiological stress, potentially 
explaining the slightly lower expression of hsp70 observed in the sum
mer, especially in the 50D fasting group, where a more pronounced 
stress response is evident in recently fasted individuals compared to 
those adapted to longer fasting periods such as 100D. Additionally, the 
negative correlation between hsp70 levels and water temperature in fish 
may be attributed to genetic adaptation to hot climatic conditions or 
other stressors (Beg et al., 2010). Overall, it has been observed that food 
deprivation induces the expression of hsp70 and hsp90 proteins in early 
life stages of rainbow trout (Oncorhynchus mykiss), suggesting their po
tential utility as markers of nutritional stress (Cara et al., 2005), a 
phenomenon also evident in our study regarding hsp90 expression in the 
100D winter season.

5. Conclusions

The summer season has exhibited apparent stability across various 
parameters including cortisol levels, skin and liver coloration and most 
of the liver gene expression. However, these findings diverge from the 
physiological reality. Notably, blood parameters such as cortisol, 
glucose, triglycerides, LDH and gene expression markers such as sod, 
gpx, hif1, gr1, hsp90 and eno have demonstrated significant variability 
between fasted and non-fasted groups, particularly notable when 
comparing fasting durations of 50D and 100D during winter. These re
sults could suggest the possibility that higher temperatures during 
summer may act as a mitigating factor against the stress induced by 
fasting, particularly during the initial 50D fasting period. However, this 
hypothesis is invalid since high temperatures, and therefore heat stress, 
have proven to be harmful to rainbow trout, affecting seriously the 
feeding, growth, immunity and even disease resistance of fish (Zhou 
et al., 2022). Moreover, parameters such as glycogen levels, skin 
chroma, NEFA, and CPK observed during summer resemble those 
observed during winter after 100 ◦C days of fasting. This implies a po
tential regulatory mechanism focus on higher temperatures as stressor, 
resulting in limited variations in response to other stressors. Conse
quently, our study reveals that higher temperatures in the summer 
season do not support the normal physiological response between 
different fasting durations, leading to an accumulative stress effect, 

which is not good practice because they do not benefit the state of well- 
being. Based on our results, for routine aquaculture practices involving 
rainbow trout, we recommend limiting short-term fasting to 50 ◦C 
d during the summer. Conversely, during winter, when optimal culture 
temperatures are maintained, fish show effective metabolic adaptation 
to longer fasting periods of around 100 ◦C d. This winter adaptation 
underscores the metabolic resilience of fish, especially in light of some 
fish farms’ use of long-term fasting to promote compensatory growth.

CRediT authorship contribution statement

Andrea Martínez Villalba: Writing – original draft, Methodology, 
Data curation. Álvaro De la Llave-Propín: Writing – review & editing, 
Methodology. Jesús De la Fuente: Writing – review & editing, Super
vision, Funding acquisition, Conceptualization. Nuria Ruiz: Writing – 
review & editing, Methodology. Concepción Pérez: Writing – review & 
editing, Validation, Methodology. Elisabet González de Chavarri: 
Writing – review & editing, Methodology. María Teresa Díaz: Writing – 
review & editing, Conceptualization. Almudena Cabezas: Writing – 
review & editing, Methodology. Roberto González-Garoz: Writing – 
review & editing, Methodology. Morris Villarroel: Writing – review & 
editing, Conceptualization. Rubén Bermejo-Poza: Writing – review & 
editing, Validation, Supervision, Data curation, Conceptualization.

Declaration of competing interest

The authors declare that they have no known competing financial 
interests or personal relationships that could have appeared to influence 
the work reported in this paper.

Data availability

Data will be made available on request.

Acknowledgements

This project was financed by the Ministerio de Agricultura, Pesca y 
Alimentación (MAPA), WELLSTUN project PNAC/21.

References

Ackerman, P.A., Forsyth, R., Mazur, C.F., Iwama, G.K., 2000. Stress hormones and the 
cellular stress response in salmonids. Fish Physiol. Biochem. 23, 327–336. https:// 
doi.org/10.1023/A:1011107610971.

Ade, R., 1989. Trout and Salmon Handbook. Facts on File Inc, New York, p. 122.
Arends, R.J., van der Gaag, R., Martens, G.J.M., Bonga, S.E.W., Flick, G., 1998. 

Differential expression of two pro-opiomelanocortin mRNAs during temperature 
stress in common carp (Cyprinus carpio L). J. Endocrinol. 159, 85–91. https://doi. 
org/10.1111/jfb.12331.

Ashley, P.J., 2007. Fish welfare: current issues in aquaculture. Appl. Anim. Behav. Sci. 
104, 199–235. https://doi.org/10.1016/j.applanim.2006.09.001.

Barcellos, L., Marqueze, A., Trapp, M., Quevedo, R.M., Ferreira, D., 2010. The effects of 
fasting on cortisol, blood glucose and liver and muscle glycogen in adult jundia 
(Rhamdia quelen). Rev. Acuaq. 300, 231–236. https://doi.org/10.1016/j. 
aquaculture.2010.01.013.

Barton, B.A., Schreck, C.B., Fowler, L.G., 1988. Fasting and diet content affect stress 
induced changes in plasma glucose and cortisol in juvenile Chinook salmon. Prog. 
Fish Cult. 50, 16–22. https://doi.org/10.1577/1548-8640(1988)050<0016: 
FADCAS>2.3.CO;2.

Basu, N., Nakano, T., Grau, E.G., Iwama, G.K., 2001. The effect of cortisol om heat shock 
protein 70 levels in two fish species. Gen. Comp. Endocrinol. 124, 97–105. https:// 
doi.org/10.1006/gcen.2001.7688.

Beck, F., Gropp, J., 1995. Estimation of the starvation losses of nitrogen and energy in the 
rainbow trout (Oncorhynchus mykiss) with special regard to protein and energy 
maintenance requirements. J. Appl. Ichthyol. 11 (3–4), 263–275. https://doi.org/ 
10.1111/j.1439-0426.1995.tb00026.x.

Beg, M.U., Al-Subiai, S., Beg, K.R., Butt, S.A., Al-Jandal, N., Al-Hasan, E., Al-Hussaini, M., 
2010. Seasonal effect on heat shock proteins in fish from Kuwait bay. Bull. Environ. 
Contam. Toxicol. 84, 91–95. https://doi.org/10.1007/s00128-009-9908-0.

Belanger, J.M., Son, J.H., Laugero, K.D., Moberg, G.P., Doroshov, S.I., Lankford, S.E., 
Cech Jr., J.J., 2001. Effects of short-term management stress and ACTH injections on 
plasma cortisol levels in cultured white sturgeon, Acipenser transmontanus. 
Aquaculture 203, 165–176. https://doi.org/10.1016/S0044-8486(01)00620-2.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

10 

https://doi.org/10.1023/A:1011107610971
https://doi.org/10.1023/A:1011107610971
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0010
https://doi.org/10.1111/jfb.12331
https://doi.org/10.1111/jfb.12331
https://doi.org/10.1016/j.applanim.2006.09.001
https://doi.org/10.1016/j.aquaculture.2010.01.013
https://doi.org/10.1016/j.aquaculture.2010.01.013
https://doi.org/10.1577/1548-8640(1988)050<0016:FADCAS>2.3.CO;2
https://doi.org/10.1577/1548-8640(1988)050<0016:FADCAS>2.3.CO;2
https://doi.org/10.1006/gcen.2001.7688
https://doi.org/10.1006/gcen.2001.7688
https://doi.org/10.1111/j.1439-0426.1995.tb00026.x
https://doi.org/10.1111/j.1439-0426.1995.tb00026.x
https://doi.org/10.1007/s00128-009-9908-0
https://doi.org/10.1016/S0044-8486(01)00620-2


Bermejo-Poza, R., De la Fuente, J., Pérez, C., Lauzurica, S., González de Chávarri, E., 
Diaz, M.T., Villarroel, M., 2016. Reducing the effect of pre-slaughter fasting on the 
stress response of rainbow trout (Oncorhynchus mykiss). Anim. Welf. 25, 339–346. 
https://doi.org/10.7120/09627286.25.3.339.

Bermejo-Poza, R., De la Fuente, J., Pérez, C., González de Chavarri, E.G., Diaz, M.T., 
Torrent, F., Villarroel, M., 2017. Determination of optimal degree days of fasting 
before slaughter in rainbow trout (Oncorhynchus mykiss). Aquaculture 473, 272–277. 
https://doi.org/10.1016/j.aquaculture.2017.01.036.

Bermejo-Poza, R., Fernández-Muela, M., De la Fuente, J., Pérez, C., de Chavarri, E.G., 
Díaz, M.T., Torrent, F., Villarroel, M., 2019. Physio-metabolic response of rainbow 
trout during prolonged food deprivation before slaughter. Fish Physiol. Biochem. 45 
(1), 253–265. https://doi.org/10.1007/s10695-018-0559-0.

Blasco, J., Fernández, J., Gutiérrez, J., 1992. Fasting and refeeding in carp, Cyprinus 
carpio L.: themobilization of reserves and plasma metabolite and hormone variations. 
J. Comp. Physiol. B. 162, 539–546. https://doi.org/10.1007/BF00264815.

Blom, S., Andersson, T.B., Forlin, L., 2000. Effects of food deprivation and handling stress 
on head kidney 17alphahydroxyprogesterone 21-hydroxylase activity, plasma 
cortisol and the activities of liver detoxification enzymes in rainbow trout. Aquat. 
Toxicol. 48, 265–274. https://doi.org/10.1016/S0166-445X(99)00031-4.

Bu, T., Xu, L., Zhu, X., Cheng, J., Li, Y., Liu, L., et al., 2021. Influence of short-term fasting 
on oxidative stress, antioxidant-related signaling molecules and autophagy in the 
intestine of adult Siniperca chuatsi. Aquac. Rep. 21, 100933. https://doi.org/ 
10.1016/j.aqrep.2021.100933.

Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., Kubista, M., Mueller, R., 
Nolan, T., Pfaffl, M.W., Shipley, G.L., Vandesompele, J., Wittwer, C.T., 2009. The 
MIQE guidelines: minimum information for publication of quantitative real-time 
PCR experiments. Clin. Chem. 55, 611–622. https://doi.org/10.1373/ 
clinchem.2008.112797.

Butzge, A.J., Yoshinaga, T.T., Acosta, O.D.M., et al., 2021. Early warming stress on 
rainbow trout juveniles impairs male reproduction but contrastingly elicits 
intergenerational thermotolerance. Sci. Rep. 11, 17053. https://doi.org/10.1038/ 
s41598-021-96514-1.

Cara, J.B., Aluru, N., Moyano, F.J., Vijayan, M.M., 2005. Food-deprivation induces 
HSP70 and HSP90 protein expression in larval gilthead sea bream and rainbow trout. 
Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 142 (4), 426–431. https://doi.org/ 
10.1016/j.cbpb.2005.09.005.

Cho, C.Y., Bureau, D.P., 1995. Determination of the energy requirements of fish with 
particular reference to salmonids. J. Appl. Ichthyol. 11 (3–4), 141–163. https://doi. 
org/10.1111/j.1439-0426.1995.tb00015.x.

Commission Internationale de l’ Eclairage (CIE), 1978. Recommendations on Uniform 
Colour Spaces Colour Difference Equations, Psychometric Colour Terms. Vol. 
Supplement No 2 To CIE Publication no 15. Colourimetry. Paris, France. Bureau 
Central de la CIE. https://doi.org/10.1016/0006-2952(61)90145-9.

Davis, K.B., Gaylord, T.G., 2011. Effect of fasting on body composition and responses to 
stress in sunshine bass. Comp. Biochem. Physiol. A. 158, 30–36. https://doi.org/ 
10.1016/j.cbpa.2010.08.019.

Dreiling, C.E., Brown, D.E., Casale, L., Kelly, L., 1987. Muscle glycogen: comparison of 
iodine binding and enzyme digestion assays and application to meat samples. Meat 
Sci. 20, 167–177. https://doi.org/10.1016/0309-1740(87)90009-X.

Echevarría, G., Martínez-Bebia, M., Zamora, S., 1997. Evolution of biometric indices and 
plasma metabolites during prolonged starvation in European sea bass (Dicentrarchus 
labrax L.). Comp. Biochem. Physiol. A. 118, 111–123. https://doi.org/10.1016/ 
S0300-9629(96)00416-1.

EFSA (European Food Safety Authority), 2008. Available at: www.efsa.europa.eu/.
Einen, O., Waagan, B., Thomassen, M.S., 1998. Starvation prior to slaughter in Atlantic 

salmon (Salmo salar). I. Effects on weight loss, body shape, slaughter- and fillet yield, 
proximate and fatty acid composition. Aquaculture 166, 85–104. https://doi.org/ 
10.1016/S0044-8486(98)00279-8.

Eliasen, K., Patursson, E., McAdam, B., Pino, E., Morro, B., et al., 2020. Liver colour 
scoring index, carotenoids and lipid content assessment as a proxy for lumpfish 
(Cyclopterus lumpus) health and welfare condition. Sci. Rep. 10 (1), 8927. https:// 
doi.org/10.1038/s41598-020-65535-7.

Ellis, T., Yildiz, H.Y., López-Olmeda, J., Spedicato, M.T., Tort, L., Øverli, Ø., Martins, C.I., 
2012. Cortisol and finfish welfare. Fish Physiol. Biochem. 38, 163–188. https://doi. 
org/10.1007/s10695-011-9568-y.

Ellman, G.L., Courtney, D., Andres, V.J., Featherstone, R.M., 1961. A new and rapid 
colorimetric determination of acetylcholinesterase activity. Biochem. Pharmacol. 7, 
88. https://doi.org/10.1016/0006-2952(61)90145-9.

Ensminger, D.C., Salvador-Pascual, A., Arango, B.G., Allen, K.N., Vázquez-Medina, J.P., 
2021. Fasting ameliorates oxidative stress: a review of physiological strategies across 
life history events in wild vertebrates. Comp. Biochem. Physiol. A Mol. Integr. 
Physiol. 256, 110929. https://doi.org/10.1016/j.cbpa.2021.110929.

Erikson, U., Misimi, E., 2008. Atlantic salmon skin and fillet color changes effected by 
perimortem handling stress, rigor mortis, and ice storage. J. Food Sci. 73 (2), 
C50–C59. https://doi.org/10.1111/j.1750-3841.2007.00617.x.

Evans, G.O., Watterson, C.L., 2009. General enzymology. In: Evans, G.O. (Ed.), Animal 
Clinical Chemistry, a Practical Guide for Toxicologists and Biochemical Researchers. 
CRC Press, New York, pp. 17–36. https://doi.org/10.1201/9781420080124.

Farbridge, K.J., Leatherland, J.F., 1992. Temporal changes in plasma thyroid hormone, 
growth hormone and free fatty acid concentrations, and hepatic 5′-monodeiodinase 
activity, lipid and protein content during chronic fasting and re-feeding in rainbow 
trout (Oncorhynchus mykiss). Fish Physiol. Biochem. 10, 245–257. https://doi.org/ 
10.1007/BF000 04518.

Farrell, A.P., Gamperl, A.K., Hicks, J.M.T., Shiels, H.A., Jain, K.E., Sciences, B., 1996. 
Maximum cardiac performance of rainbow trout (Oncorhynchus mykiss) at 

temperatures approaching their upper lethal limit. J. Exp. Biol. 199, 663–672. 
https://doi.org/10.1242/jeb.199.3.663.

Favero, G.C., Gimbo, R.Y., Franco Montoya, L.N., Zanuzzo, F.S., Urbinati, E.C., 2018. 
Fasting and refeeding lead to more efficient growth in lean pacu (Piaractus 
mesopotamicus). Aquac. Res. 49, 359–366. https://doi.org/10.1111/are.13466.

FAWC (Farmed Animal Welfare Council), 1996. Report on the Welfare of Farmed Fish. 
Available at: http://www.fawc.org.uk/reports/fish/fishrtoc.htm.

Feidantsis, K., Pörtner, H.O., Antonopoulou, E., Michaelidis, B., 2015. Synergistic effects 
of acute warming and low pH on celular stress responses of the gilthead seabream 
Sparus aurata. J. Comp. Physiol. B. 185, 185–205. https://doi.org/10.1007/s00360- 
014-0875-3.

Feng, G., Shi, X., Huang, X., Zhuang, P., 2011. Oxidative stress and antioxidant defenses 
after long-term fasting in blood of Chinese sturgeon (Acipenser sinensis). Procedia 
Environ. Sci. 8, 469–475. https://doi.org/10.1016/j.proenv.2011.10.074.

Fernández-Muela, M., Bermejo-Poza, R., Cabezas, A., Pérez, C., González de Chavarri, E., 
Díaz, M.T., Torrent, F., Villarroel, M., De la Fuente, J., 2023. Effects of fasting on 
intermediary metabolism enzymes in the liver and muscle of rainbow trout. Fishes 8, 
53. https://doi.org/10.3390/fishes8010053.

Florescu, I.E., Georgescu, S.E., Dudu, A., Balaș, M., Voicu, S., Grecu, I., et al., 2021. 
Oxidative stress and antioxidant defense mechanisms in response to starvation and 
refeeding in the intestine of stellate sturgeon (Acipenser stellatus) juveniles from 
aquaculture. Animals 11 (1), 76. https://doi.org/10.3390/ani11010076.

Fonseca, V.F., França, S., Vasconcelos, R.P., Serafim, A., Company, R., Lopes, B., et al., 
2011. Short-term variability of multiple biomarker response in fish from estuaries: 
influence of environmental dynamics. Mar. Environ. Res. 72 (4), 172–178. https:// 
doi.org/10.1016/j.marenvres.2011.08.001.

Frohn, L., Peixoto, D., Terrier, F., Costas, B., Bugeon, J., Cartier, C., et al., 2024. Gut 
physiology of rainbow trout (Oncorhynchus mykiss) is influenced more by short-term 
fasting followed by refeeding than by feeding fishmeal-free diets. Fish Physiol. 
Biochem. 50, 1281–1303. https://doi.org/10.1007/s10695-024-01339-0.

Furné, M., Morales, A.E., Trenzado, C.E., García-Gallego, M., Hidalgo, M.C., 
Domezain, A., Rus, A.S., 2012. The metabolic effects of prolonged starvation and 
refeeding in sturgeon and rainbow trout. J. Comp. Physiol. B. 182, 63–76. https:// 
doi.org/10.1007/s00360-011-0596-9.

García-Meilán, I., Tort, L., Khansari, A.R., 2022. Rainbow trout integrated response after 
recovery from short-term acute hypoxia. Front. Physiol. 13, 1021927. https://doi. 
org/10.3389/fphys.2022.1021927.

Gaspar, J.M., Velloso, L.A., 2018. Hypoxia inducible factor as a central regulator of 
metabolism–implications for the development of obesity. Front. Neurosci. 12. 
https://doi.org/10.3389/fnins.2018.00813.

Grutter, A.S., Pankhurst, N.W., 2000. The effects of capture, handling, confinement and 
ectoparasite load on plasma levels of cortisol, glucose and lactate in the coral reef 
fish Hemygimnus melapterus. J. Fish Biol. 57, 391–401. https://doi.org/10.1111/ 
j.1095-8649.2000.tb02179.x.

Guderley, H., Lapointe, D., Bédard, M., Dutil, J.D., 2003. Metabolic priorities during 
starvation: enzyme sparing in liver and white muscle of Atlantic cod, Gadus morhua 
L. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 135 (2), 347–356. https://doi. 
org/10.1016/S1095-6433(03)00089-8.

Hassan, A.H., Hozzein, W.N., Mousa, A.S., Rabie, W., Alkhalifah, D.H.M., Selim, S., 
AbdElgawad, H., 2020. Heat stress as an innovative approach to enhance the 
antioxidant production in Pseudooceanicola and Bacillus isolates. Sci. Rep. 10 (1), 
15076. https://doi.org/10.1038/s41598-020-72054-y.

Höglund, E., Balm, P.H., Winberg, S., 2000. Skin darkening, a potential social signal in 
subordinate arctic charr (Salvelinus alpinus): the regulatory role of brain monoamines 
and pro-opiomelanocortin-derived peptides. J. Exp. Biol. 203 (11), 1711–1721. 
https://doi.org/10.1242/jeb.203.11.1711.

Holen, E., Austgulen, M.H., Espe, M., 2021. RNA form baker’s yeast cultured with and 
without lipopolysaccharide (LPS) modulates gene transcription in an intestinal 
epithelial cell model, RTgutGC from rainbow trout (Oncorhynchus mykiss). Fish 
Shellfish Immunol. 119, 397–408. https://doi.org/10.1016/j.fsi.2021.10.018.

Huang, J., Li, Y., Liu, Z., Kang, Y., Wang, J., 2018. Transcriptomic responses to heat 
stress in rainbow trout Oncorhynchus mykiss head kidney. Fish Shellfish Immunol. 82, 
32–40. https://doi.org/10.1016/j.fsi.2018.08.002.

Hultmann, L., Minh Phu, T., Tobiassen, T., Aas-Hansen, O., Rustad, T., 2012. Effects of 
preslaughter stress on proteolytic enzyme activities and muscle quality of farmed 
Atlantic cod (Gadus morhua). Food Chem. 134, 1399–1408. https://doi.org/ 
10.1016/j.foodchem.2012.03.038.

Hvas, M., Kolarevic, J., Noble, C., Oppedal, F., Stien, L.H., 2024. Fasting and its 
implications for fish welfare in Atlantic salmon aquaculture. Rev. Aquac. 16 (3), 
1308–1332. https://doi.org/10.1111/raq.12898.

Iger, Y., Abraham, M., Zhang, L., Stoumboudi, M., Alexis, M., Tsangaris, K., 
WendelaarBonga, S., van Ham, E., 2001. Fish skin alterations as indicators for stress 
in fresh and seawater aquaculture. Eur. Aquac. Soc. 29, 109–110.

Ings, J.S., Servos, M.R., Vijayan, M.M., 2011. Hepatic transcriptomics and protein 
expression in rainbow trout exposed to municipal wastewater effluent. Environ. Sci. 
Technol. 45, 2368–2376. https://doi.org/10.1021/es103122g.

Jeffrey, J.D., Gollock, M.J., Gilmour, K.M., 2014. Social stress modulates the cortisol 
response to an acute stressor in rainbow trout (Oncorhynchus mykiss). Gen. Comp. 
Endocrinol. 196, 81. https://doi.org/10.1016/j.ygcen.2013.11.010.

Jentoft, S., Aastveit, A.H., Torjesen, P.A., Andersen, O., 2005. Effects of stress on growth, 
cortisol and glucose levels in non-domesticated Eurasian perch (Perca fluviatilis) and 
domesticated rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. 141, 
353–358. https://doi.org/10.1016/j.cbpb.2005.06.006.

Jiang, X., Dong, S., Liu, R., Huang, M., Dong, K., Ge, J., et al., 2021. Effects of 
temperature, dissolved oxygen, and their interaction on the growth performance and 

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

11 

https://doi.org/10.7120/09627286.25.3.339
https://doi.org/10.1016/j.aquaculture.2017.01.036
https://doi.org/10.1007/s10695-018-0559-0
https://doi.org/10.1007/BF00264815
https://doi.org/10.1016/S0166-445X(99)00031-4
https://doi.org/10.1016/j.aqrep.2021.100933
https://doi.org/10.1016/j.aqrep.2021.100933
https://doi.org/10.1373/clinchem.2008.112797
https://doi.org/10.1373/clinchem.2008.112797
https://doi.org/10.1038/s41598-021-96514-1
https://doi.org/10.1038/s41598-021-96514-1
https://doi.org/10.1016/j.cbpb.2005.09.005
https://doi.org/10.1016/j.cbpb.2005.09.005
https://doi.org/10.1111/j.1439-0426.1995.tb00015.x
https://doi.org/10.1111/j.1439-0426.1995.tb00015.x
https://doi.org/10.1016/0006-2952(61)90145-9
https://doi.org/10.1016/j.cbpa.2010.08.019
https://doi.org/10.1016/j.cbpa.2010.08.019
https://doi.org/10.1016/0309-1740(87)90009-X
https://doi.org/10.1016/S0300-9629(96)00416-1
https://doi.org/10.1016/S0300-9629(96)00416-1
http://www.efsa.europa.eu/
https://doi.org/10.1016/S0044-8486(98)00279-8
https://doi.org/10.1016/S0044-8486(98)00279-8
https://doi.org/10.1038/s41598-020-65535-7
https://doi.org/10.1038/s41598-020-65535-7
https://doi.org/10.1007/s10695-011-9568-y
https://doi.org/10.1007/s10695-011-9568-y
https://doi.org/10.1016/0006-2952(61)90145-9
https://doi.org/10.1016/j.cbpa.2021.110929
https://doi.org/10.1111/j.1750-3841.2007.00617.x
https://doi.org/10.1201/9781420080124
https://doi.org/10.1007/BF000 04518
https://doi.org/10.1007/BF000 04518
https://doi.org/10.1242/jeb.199.3.663
https://doi.org/10.1111/are.13466
http://www.fawc.org.uk/reports/fish/fishrtoc.htm
https://doi.org/10.1007/s00360-014-0875-3
https://doi.org/10.1007/s00360-014-0875-3
https://doi.org/10.1016/j.proenv.2011.10.074
https://doi.org/10.3390/fishes8010053
https://doi.org/10.3390/ani11010076
https://doi.org/10.1016/j.marenvres.2011.08.001
https://doi.org/10.1016/j.marenvres.2011.08.001
https://doi.org/10.1007/s10695-024-01339-0
https://doi.org/10.1007/s00360-011-0596-9
https://doi.org/10.1007/s00360-011-0596-9
https://doi.org/10.3389/fphys.2022.1021927
https://doi.org/10.3389/fphys.2022.1021927
https://doi.org/10.3389/fnins.2018.00813
https://doi.org/10.1111/j.1095-8649.2000.tb02179.x
https://doi.org/10.1111/j.1095-8649.2000.tb02179.x
https://doi.org/10.1016/S1095-6433(03)00089-8
https://doi.org/10.1016/S1095-6433(03)00089-8
https://doi.org/10.1038/s41598-020-72054-y
https://doi.org/10.1242/jeb.203.11.1711
https://doi.org/10.1016/j.fsi.2021.10.018
https://doi.org/10.1016/j.fsi.2018.08.002
https://doi.org/10.1016/j.foodchem.2012.03.038
https://doi.org/10.1016/j.foodchem.2012.03.038
https://doi.org/10.1111/raq.12898
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0265
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0265
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0265
https://doi.org/10.1021/es103122g
https://doi.org/10.1016/j.ygcen.2013.11.010
https://doi.org/10.1016/j.cbpb.2005.06.006


condition of rainbow trout (Oncorhynchus mykiss). J. Therm. Biol. 98, 102928. 
https://doi.org/10.1016/j.jtherbio.2021.102928.

Karatas, T., Onalan, S., Yildirim, S., 2021. Effects of prolonged fasting on levels of 
metabolites, oxidative stress, immune-related gene expression, histopathology, and 
DNA damage in the liver and muscle tissues of rainbow trout (Oncorhynchus mykiss). 
Fish Physiol. Biochem. 47 (4), 1119–1132. https://doi.org/10.1007/s10695-021- 
00949-2.

Kirsch, R., Humbert, W., Rodeau, J.L., 1984. Control of the blood osmolarity in fishes 
with references to the functional anatomy of the gut. Osmoregul. Estuar. Marine 
Anim. 9, 67–92. https://doi.org/10.1029/LN009.

Kozera, B., Rapacz, M., 2013. Reference genes in real-time PCR. J. Appl. Genet. 54, 
391–406. https://doi.org/10.1007/s13353-013-0173-x.

Kuhn, E.R., Corneillie, S., Ollevier, F., 1986. Circadian variations in plasma osmolality, 
electrolytes, glucose and cortisol in carp (Cyprinus carpio). Gen. Comp. Endocrinol. 
61, 459–468. https://doi.org/10.1016/0016-6480(86)90234-0.

Laiz-Carrión, R., Viana, I.R., Cejas, J.R., Ruiz-Jarabo, I., Jerez, S., Martos, J.A., 
Eduardo, A.B., Mancera, J.M., 2012. Influence of food deprivation and high stocking 
density on energetic metabolism and stress response in red porgy, Pagrus L. Aquac. 
Int. 20, 585–599. https://doi.org/10.1007/s10499-011-9488-y.

Li, D., Fu, C., Wang, Y., Zhu, Z., Hu, W., 2011. The hematological response to exhaustive 
exercise in ‘all-fish’ growth hormone transgenic common carp (Cyprinus carpio L.). 
Aquaculture 311, 263–268. https://doi.org/10.1016/j.aquac ulture.2010.12.002.

Li, X., Zhang, Y., Fu, S., 2020. Effects of short-term fasting on spontaneous activity and 
excess post-exercise oxygen consumption in four juvenile fish species with different 
foraging strategies. Biol. Open 9 (9), bio051755. https://doi.org/10.1242/ 
bio.051755.

Li, S., Liu, Y., Li, B., Ding, L., Wei, X., Wang, P., et al., 2022. Physiological responses to 
heat stress in the liver of rainbow trout (Oncorhynchus mykiss) revealed by UPLC- 
QTOF-MS metabolomics and biochemical assays. Ecotoxicol. Environ. Saf. 242. 
https://doi.org/10.1016/j.ecoenv.2022.113949.

Liew, H.J., Sinha, A.K., Mauro, N., Diricx, M., 2012. Fasting goldfish, Carassius auratus, 
and common carp, Cyprinus carpio, use different metabolic strategies when 
swimming. Comp. Biochem. Physiol. A. 163, 327–335. https://doi.org/10.1016/j. 
cbpa.2012.07.012.

Lim, K.C., Yusoff, F.M., Shariff, M., Kamarudin, M.S., 2018. Astaxanthin as feed 
supplement in aquatic animals. Rev. Aquac. 10 (3), 738–773. https://doi.org/ 
10.1111/raq.12200.

Lines, J.A., Spence, J., 2012. Safeguarding the welfare of farmed fish at harvest. Fish 
Physiol. Biochem. 38, 153–162. https://doi.org/10.1007/s10695-011-9561-5.

Liu, H., Yang, R., Fu, Z., Yu, G., Li, M., Dai, S., et al., 2023. Acute thermal stress increased 
enzyme activity and muscle energy distribution of yellowfin tuna. PLoS ONE 18 (10). 
https://doi.org/10.1371/journal.pone.0289606.

López-Luna, J., Vásquez, L., Torrent, F., Villarroel, M., 2013. Short-term fasting and 
welfare prior to slaughter in rainbow trout, Oncorhynchus mykiss. Aquaculture 400, 
142–147. https://doi.org/10.1016/j.aquaculture.2013.03.009.

López-Luna, J., Bermejo-Poza, R., Bravo, F.T., Villarroel, M., 2016. Effect of degree-days 
of fasting stress on rainbow trout, Oncorhynchus mykiss. Aquaculture 462, 109–114. 
https://doi.org/10.1016/j.aquaculture.2016.05.017.

Luo, Z., Liu, Y.J., Mai, K.S., Tian, L.X., Tan, X.Y., Shi, J.F., 2006. Effects of feeding levels 
on growth performance, feed utilization, body composition, and apparent 
digestibility coefficients of nutrients for grouper Epinephelus coioides juveniles. 
J. World Aquacult. Soc. 37, 32–40. https://doi.org/10.1111/j.1749- 
7345.2006.00004.x.

Luo, Z., Tan, X.Y., Wang, W.M., Fan, Q.X., 2009. Effects of long-term starvation on body 
weight and body composition of juvenile channel catfish, Ictalurus punctatus, with 
special emphasis on amino acid and fatty acid changes. J. Appl. Ichthyol. 25 (2), 
184–189. https://doi.org/10.1111/j.1439-0426.2009.01216.x.

Mancera, J.M., Vargas-Chacoff, L., García-López, A., Kleszczynska, A., Kalamarz, H., 
Martínez-Rodríguez, G., Kulczykowska, E., 2008. High density and food deprivation 
affect arginine vasotocin, isotocin and melatonin in gilthead sea bream (Sparus 
aurata). Comp. Biochem. Physiol. A 149, 92–97. https://doi.org/10.1016/j. 
cbpa.2007.10.016.

Marandel, L., Seiliez, I., Véron, V., Skiba-Cassy, S., Panserat, S., 2015. New insights into 
the nutritional regulation of gluconeogenesis in carnivorous rainbow trout 
(Oncorhynchus mykiss): a gene duplication trail. Physiol. Genomics 47 (7), 253–263. 
https://doi.org/10.1152/physiolgenomics.00026.2015.

Morales, A.E., Pérez-Jiménez, A., Hidalgo, M.C., Abellán, E., & Cardenete, G., 2004. 
Oxidative stress and antioxidant defenses after prolonged starvation in Dentex dentex 
liver. Comp. Biochem. Physiol. Part C: Toxicol. Pharmacol. 139(1–3), 153–161. doi:
https://doi.org/10.1016/j.cca.2004.10.008.

Navarro, I., Gutiérrez, J., 1995. 4, 393–434. doi:https://doi.org/10.1016/S1873-0140 
(06)80020-2.

Millán-Cubillo, A.F., Martos-Sitcha, J.A., Ruiz-Jarabo, I., Cárdenas, S., Mancera, J.M., 
2016. Low stocking density negatively affects growth, metabolism and stress 
pathways in juvenile specimens of meagre (Argyrosomus regius, Asso 1801). 
Aquaculture 451, 87–92.

Nikki, J., Pirhonen, J., Jobling, M., Karjalainen, J., 2004. Compensatory growth in 
juvenile rainbow trout, Oncorhynchus mykiss (Walbaum), held individually. 
Aquaculture 235, 285–296. https://doi.org/10.1016/j.aquaculture.2003.10.017.

Noble, C., Gismervik, K., Iversen, M.H., Kolarevic, J., Nilsson, J., Stien, L.H., Turnbull, J. 
F., 2020. Welfare Indicators for Farmed Rainbow Trout: Tools for Assessing Fish 
Welfare, p. 310. Available at: https://nofima.no/fishwell/trout/.

Ntantali, O., Malandrakis, E.E., Abbink, W., Bastiaansen, J., Chatzoglou, E., 
Karapanagiotidis, I.T., et al., 2023. Effects of short-term intermittent fasting on 
growth performance, fatty acids profile, glycolysis and cholesterol synthesis gene 

expression in European seabass Dicentrarchus labrax. Fishes 8 (12), 582. https://doi. 
org/10.3390/fishes8120582.

O’Connor, K.I., Metcalfe, N.B., Taylor, A.C., 1999. Does darkening signal submission in 
territorial contests between juvenile Atlantic salmon, Salmo salar? Anim. Behav. 58 
(6), 1269–1276. https://doi.org/10.1006/anbe.1999.1260.

Olsen, R.E., Sundell, K., Ringø, E., Myklebust, R., Hemre, G.I., Hansen, T., Karlsen, Ø., 
2008. The acute stress response in fed and food deprived Atlantic cod, Gadus morhua 
L. Aquaculture 280, 232–241. https://doi.org/10.1016/j.aquaculture.2008.05.006.

Ortiz, R.M., Wade, C.E., Ortiz, C.L., 2001. Effects of prolonged fasting on plasma cortisol 
and TH in postweaned northern elephant seal pups. Am. J. Phys. Regul. Integr. 
Comp. Phys. 280, 790–795. https://doi.org/10.1152/ajpregu.2001.280.3.R790.

Pascual, P., Pedrajas, J.R., Toribio, F., López-Barea, J., Peinado, J., 2003. Effect of food 
deprivation on oxidative stress biomarkers in fish (Sparus aurata). Chem. Biol. 
Interact. 145 (2), 191–199. https://doi.org/10.1016/S0009-2797(03)00002-4.

Pavlidis, M., Papandroulakis, N., Divanach, P., 2006. A method for the comparison of 
chromaticity parameters in fish skin: preliminary results for coloration pattern of red 
skin Sparidae. Aquaculture 258, 211–219. https://doi.org/10.1016/j. 
aquaculture.2006.05.028.

Peres, H., Santos, S., Oliva-Teles, A., 2013. Selected plasma biochemistry parameters in 
gilthead seabream (Sparus aurata) juveniles. J. Appl. Ichthyol. 29, 630–636. https:// 
doi.org/10.1111/j.1439-0426.2012.02049.x.

Peres, H., Santos, S., Oliva-Teles, A., 2014. Blood chemistry profile as indicator of 
nutritional status in European seabass (Dicentrarchus labrax). Fish Physiol. Biochem. 
40, 1339–1347. https://doi.org/10.1007/s10695-014-9928-5.

Polakof, S., Arjona, F.J., Sangiao-Alvarellos, S., Del Río, M.P.M., Mancera, J.M., 
Soengas, J.L., 2006. Food deprivation alters osmoregulatory and metabolic responses 
to salinity acclimation in gilthead sea bream Sparus auratus. J. Comp. Physiol. B. 
176, 441–452. https://doi.org/10.1007/s00360-006-0065-z.

Poli, B.M., Parisi, G., Scappini, F., Zampacavallo, G., 2005. Fish welfare and quality as 
affected by pre-slaughter and slaughter management. Aquac. Int. 13, 29–49. https:// 
doi.org/10.1007/s10499-004-9035-1.

Pottinger, T.G., 1998. Changes in blood cortisol, glucose and lactate in carp retained in 
anglers keepnets. J. Fish Biol. 53, 728–742. https://doi.org/10.1111/j.1095- 
8649.1998.tb01828.x.

Pottinger, T.G., 2010. A multivariate comparison of the stress response in three salmonid 
and three cyprinid species: evidence for inter-family differences. J. Fish Biol. 76, 
601–621. https://doi.org/10.1111/j.1095-8649.2009.02516.x.

Pottinger, T.G., Rand-Weaver, M., Sumpter, J.P., 2003. Overwinter fasting and re-feeding 
in rainbow trout: plasma growth hormone and cortisol levels in relation to energy 
mobilization. Comp. Biochem. Physiol. B 136, 403–417. https://doi.org/10.1016/ 
S1096-4959(03)00212-4.

Regost, C., Arzel, J., Cardinal, M., Laroche, M., Kaushik, S.J., 2001. Fat deposition and 
flesh quality in seawater reared triploid Brown trout (Salmo trutta) as affected by 
dietary fat levels and starvation. Aquaculture 193, 325–345. https://doi.org/ 
10.1016/S0044-8486(00)00498-1.

Robb, D.H.F., 2008. Welfare of fish at harvest. In: Branson, E.J. (Ed.), Fish Welfare. 
Blackwell Publishing, Oxford, pp. 217–242. https://doi.org/10.1002/ 
9780470697610.

Sadoul, B., Geffroy, B., 2019. Measuring cortisol, the major stress hormone in fishes. 
J. Fish Biol. 94 (4), 540–555. https://doi.org/10.1111/jfb.13904.

Salazar-Duque, D., Holguín, J.P., Estrella, I.A., Lomas Martínez, G., 2019. Improving the 
quality of rainbow trout meat through the Ikejime slaughter technique: Ecuador 
case. CIENCIA ergo-sum 26 (1). https://doi.org/10.30878/ces.v26n1a10.

Salem, M., Silverstein, J., Rexroad, C.E., Yao, J., 2007. Effect of starvation on global gene 
expression and proteolysis in rainbow trout (Oncorhynchus mykiss). BMC Genomics 8, 
1–16. https://doi.org/10.1186/1471-2164-8-328.

Sánchez-Moya, A., Perelló-Amorós, M., Vélez, E.J., Viñuales, J., García-Pérez, I., 
Blasco, J., et al., 2022. Interaction between the effects of sustained swimming 
activity and dietary macronutrient proportions on the redox status of gilthead sea 
bream juveniles (Sparus aurata). Antioxidants 11 (2), 319. https://doi.org/10.3390/ 
antiox11020319.

Sangiao-Alvarellos, S., Guzmán, J.M., Láiz-Carrión, R., Míguez, J.M., Martín Del Río, M. 
P., Mancera, J.M., Soengas, J.L., 2005. Interactive effects of high stocking density 
and food deprivation on carbohydrate metabolism in several tissues of gilthead sea 
bream Sparus auratus. J. Exp. Zool. A Comp. Exp. Biol. 303 (9), 761–775. https://doi. 
org/10.1002/jez.a.203.

Small, B.C., 2005. Effect of fasting on nychthemeral concentration of plasma growth 
hormone (GH), insulin-like growth factor I (IGF-I), and cortisol in channel catfish 
(Ictalurus punctatus). Comp. Biochem. Physiol. B 142, 217–223. https://doi.org/ 
10.1016/j.cbpb.2005.07.008.

Soengas, J.L., Strong, E.F., Fuentes, J., Veira, J.A.R., Andres, M.D., 1996. Food 
deprivation and refeeding in Atlantic salmon, Salmo salar: effects on brain and liver 
carbohydrate and ketone bodies metabolism. Fish Physiol. Biochem. 15, 491–511. 
https://doi.org/10.1007/BF01874923.

Soimato, A.J., Raberg, C.M.I., Gassmann, M., Sistonen, L., Nikinmaa, M., 2001. 
Characterization of a hypoxia-inducible factor (HIF-1a) from rainbow trout. 
J. Biochem. Chem. 276. https://doi.org/10.1074/jbc.M009057200.

Soñanez-Organis, J.G., Vázquez-Medina, J.P., Crocker, D.E., Ortiz, R.M., 2013. 
Prolonged fasting activates hypoxia inducible factors-1α,-2α and-3α in a tissue- 
specific manner in northern elephant seal pups. Gene 526 (2), 155–163. https://doi. 
org/10.1016/j.gene.2013.05.004.

Sumpter, J.P., Le Bail, P.Y., Pickering, A.D., Pottinger, T.G., Carragher, J.F., 1991. The 
effect of starvation on growth and plasma growth hormone concentrations of 
rainbow trout, Oncorhynchus mykiss. Gen. Comp. Endocrinol. 83, 94–102. https:// 
doi.org/10.1016/0016-6480(91)90109-J.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

12 

https://doi.org/10.1016/j.jtherbio.2021.102928
https://doi.org/10.1007/s10695-021-00949-2
https://doi.org/10.1007/s10695-021-00949-2
https://doi.org/10.1029/LN009
https://doi.org/10.1007/s13353-013-0173-x
https://doi.org/10.1016/0016-6480(86)90234-0
https://doi.org/10.1007/s10499-011-9488-y
https://doi.org/10.1016/j.aquac ulture.2010.12.002
https://doi.org/10.1242/bio.051755
https://doi.org/10.1242/bio.051755
https://doi.org/10.1016/j.ecoenv.2022.113949
https://doi.org/10.1016/j.cbpa.2012.07.012
https://doi.org/10.1016/j.cbpa.2012.07.012
https://doi.org/10.1111/raq.12200
https://doi.org/10.1111/raq.12200
https://doi.org/10.1007/s10695-011-9561-5
https://doi.org/10.1371/journal.pone.0289606
https://doi.org/10.1016/j.aquaculture.2013.03.009
https://doi.org/10.1016/j.aquaculture.2016.05.017
https://doi.org/10.1111/j.1749-7345.2006.00004.x
https://doi.org/10.1111/j.1749-7345.2006.00004.x
https://doi.org/10.1111/j.1439-0426.2009.01216.x
https://doi.org/10.1016/j.cbpa.2007.10.016
https://doi.org/10.1016/j.cbpa.2007.10.016
https://doi.org/10.1152/physiolgenomics.00026.2015
https://doi.org/10.1016/j.cca.2004.10.008
https://doi.org/10.1016/S1873-0140(06)80020-2
https://doi.org/10.1016/S1873-0140(06)80020-2
http://refhub.elsevier.com/S0044-8486(24)01212-2/optjcQ2rDXZi7
http://refhub.elsevier.com/S0044-8486(24)01212-2/optjcQ2rDXZi7
http://refhub.elsevier.com/S0044-8486(24)01212-2/optjcQ2rDXZi7
http://refhub.elsevier.com/S0044-8486(24)01212-2/optjcQ2rDXZi7
https://doi.org/10.1016/j.aquaculture.2003.10.017
https://nofima.no/fishwell/trout/
https://doi.org/10.3390/fishes8120582
https://doi.org/10.3390/fishes8120582
https://doi.org/10.1006/anbe.1999.1260
https://doi.org/10.1016/j.aquaculture.2008.05.006
https://doi.org/10.1152/ajpregu.2001.280.3.R790
https://doi.org/10.1016/S0009-2797(03)00002-4
https://doi.org/10.1016/j.aquaculture.2006.05.028
https://doi.org/10.1016/j.aquaculture.2006.05.028
https://doi.org/10.1111/j.1439-0426.2012.02049.x
https://doi.org/10.1111/j.1439-0426.2012.02049.x
https://doi.org/10.1007/s10695-014-9928-5
https://doi.org/10.1007/s00360-006-0065-z
https://doi.org/10.1007/s10499-004-9035-1
https://doi.org/10.1007/s10499-004-9035-1
https://doi.org/10.1111/j.1095-8649.1998.tb01828.x
https://doi.org/10.1111/j.1095-8649.1998.tb01828.x
https://doi.org/10.1111/j.1095-8649.2009.02516.x
https://doi.org/10.1016/S1096-4959(03)00212-4
https://doi.org/10.1016/S1096-4959(03)00212-4
https://doi.org/10.1016/S0044-8486(00)00498-1
https://doi.org/10.1016/S0044-8486(00)00498-1
https://doi.org/10.1002/9780470697610
https://doi.org/10.1002/9780470697610
https://doi.org/10.1111/jfb.13904
https://doi.org/10.30878/ces.v26n1a10
https://doi.org/10.1186/1471-2164-8-328
https://doi.org/10.3390/antiox11020319
https://doi.org/10.3390/antiox11020319
https://doi.org/10.1002/jez.a.203
https://doi.org/10.1002/jez.a.203
https://doi.org/10.1016/j.cbpb.2005.07.008
https://doi.org/10.1016/j.cbpb.2005.07.008
https://doi.org/10.1007/BF01874923
https://doi.org/10.1074/jbc.M009057200
https://doi.org/10.1016/j.gene.2013.05.004
https://doi.org/10.1016/j.gene.2013.05.004
https://doi.org/10.1016/0016-6480(91)90109-J
https://doi.org/10.1016/0016-6480(91)90109-J


Teles, M., Tridico, R., Callol, A., Fierro-Castro, C., Tort, L., 2013. Differential expression 
of the corticosteroid receptors GR1, GR2 and MR in rainbow trout organs with slow 
release cortisol implants. Comp. Biochem. Physiol. A Mol. Integr. Physiol. 164, 
506–511. https://doi.org/10.1016/j.cbpa.2012.12.018.

Thomas, P.M., Pankhurst, N.W., Bremner, H.A., 1999. The effect of stress and exercise on 
post-mortem biochemistry of Atlantic salmon and rainbow trout. J. Fish Biol. 54, 
1177–1196. https://doi.org/10.1006/jfbi.1999.0950.

Trampel, D., Sell, J., Ahn, D., Sebranek, J., 2005. Preharvest feed withdrawal affects liver 
lipid and liver color in broiler chickens. Poult. Sci. 84, 137–142. https://doi.org/ 
10.1093/ps/84.1.137.

Umminger, B.L., 1971. Patterns of osmoregulation in freshwater fishes at temperatures 
near freezing. Physiol. Zool. 44 (1), 20–27.

Vallejos-Vidal, E., Sanz-Milián, B., Teles, M., Reyes-Cerpa, S., Mancera, J.M., Tort, L., 
Reyes-Lopez, F.E., 2022. The gene expression profile of the glucocorticoid receptor 1 
(gr1) but not gr2 is modulated in mucosal tissues of gilthead sea bream (Sparus 
aurata) exposed to acute air-exposure stress. Front. Mar. Sci. 9. https://doi.org/ 
10.3389/fmars.2022.977719.

Vijayan, P., Prashanth, H.C., Vijayaraj, P., Dhanaraj, S.A., Badami, S., Suresh, B., 2003. 
Hepatoprotective effect of the total alkaloid fraction of Solanum pseudocapsicum 
leaves. Pharm. Biol. 41 (6), 443–448. https://doi.org/10.1076/ 
phbi.41.6.443.17827.

Villalba, A.M., De la Llave-Propín, Á., De la Fuente, J., Pérez, C., de Chavarri, E.G., 
Díaz, M.T., Cabezas, A., González-Garoz, R., Torrent, F., Villarroel, M., Bermejo- 
Poza, R., 2023. Using underwater currents as an occupational enrichment method to 
improve the stress status in rainbow trout. Fish Physiol. Biochem. 1-13. https://doi. 
org/10.1007/s10695-023-01277-3.

Vissio, P.G., Darias, M.J., Di Yorio, M.P., Sirkin, D.I.P., Delgadin, T.H., 2021. Fish skin 
pigmentation in aquaculture: the influence of rearing conditions and its 
neuroendocrine regulation. Gen. Comp. Endocrinol. 301, 113662.

Von Herbing, I.H., White, L., 2002. The effects of body mass and feeding on metabolic 
rate in small juvenile Atlantic cod. J. Fish Biol. 61 (4), 945–955. https://doi.org/ 
10.1111/j.1095-8649.2002.tb01854.x.

Vranković, J., Stanković, M., Marković, Z., 2021. Levels of antioxidant enzyme activities 
in cultured rainbow trout (Oncorhynchus mykiss) fed with different diet 
compositions. Bull. Eur. Assoc. Fish Pathol. 41 (4), 135–145. https://doi.org/ 
10.48045/001c.31752.

Waagbø, R., Jørgensen, S.M., Timmerhaus, G., Breck, O., Olsvik, P.A., 2017. Short-term 
starvation at low temperature prior to harvest does not impact the health and acute 
stress response of adult Atlantic salmon. PeerJ 5, e3273. https://doi.org/10.7717/ 
peerj.3273.

Wang, Z., Pu, D., Zheng, J., Li, P., Lü, H., Wei, X., et al., 2023. Hypoxia-induced 
physiological responses in fish: from organism to tissue to molecular levels. 
Ecotoxicol. Environ. Saf. 267. https://doi.org/10.1016/j.ecoenv.2023.115609.

Weber, T.E., Bosworth, B.G., 2005. Effects of 28 day exposure to cold temperature or feed 
restriction on growth, body composition, and expression of genes related to muscle 
growth and metabolism in channel catfish. Aquaculture 246, 483–492. https://doi. 
org/10.1016/j.aquaculture.2005.02.032.

Werner, I., Viant, M.R., Rosenblum, E.S., Gantner, A.S., Tjeerdema, R.S., Johnson, M.L., 
2006. Cellular responses to temperature stress in steelhead trout (Onchorynchus 
mykiss) parr with different rearing histories. Fish Physiol. Biochem. 32, 261–273. 
https://doi.org/10.1007/s10695-006-9105-6.

Woo, N.Y., Fung, A.C., 1981. Studies on the biology of the red sea bream, Chrysophrys 
major—II. Salinity adaptation. Comp. Biochem. Physiol. A Physiol. 69 (2), 237–242. 
https://doi.org/10.1016/0300-9629(81)90287-5.

Yang, S., He, K., Yan, T., Wu, H., Zhou, J., Zhao, L., et al., 2019. Effect of starvation and 
refeeding on oxidative stress and antioxidant defenses in Yangtze sturgeon (Acipenser 
dabryanus). Fish Physiol. Biochem. 45, 987–995. https://doi.org/10.1007/s10695- 
019-0609-2.

Zhang, X.D., Wu, T.X., Cai, L.S., Zhu, Y.F., 2007. Influence of fasting on muscle 
composition and antioxidant defenses of market-size Sparus macrocephalus. 
J Zhejiang Univ Sci B 8 (12), 906–911. https://doi.org/10.1631/jzus.2007.B0906.

Zhou, C., Yang, S., Ka, W., Gao, P., Li, Y., Long, R., Wang, J., 2022. Association of gut 
microbiota with metabolism in rainbow trout under acute heat stress. Front. 
Microbiol. 13, 846336. https://doi.org/10.3389/fmicb.2022.846336.

A.M. Villalba et al.                                                                                                                                                                                                                             Aquaculture 596 (2025) 741750 

13 

https://doi.org/10.1016/j.cbpa.2012.12.018
https://doi.org/10.1006/jfbi.1999.0950
https://doi.org/10.1093/ps/84.1.137
https://doi.org/10.1093/ps/84.1.137
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0525
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0525
https://doi.org/10.3389/fmars.2022.977719
https://doi.org/10.3389/fmars.2022.977719
https://doi.org/10.1076/phbi.41.6.443.17827
https://doi.org/10.1076/phbi.41.6.443.17827
https://doi.org/10.1007/s10695-023-01277-3
https://doi.org/10.1007/s10695-023-01277-3
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0545
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0545
http://refhub.elsevier.com/S0044-8486(24)01212-2/rf0545
https://doi.org/10.1111/j.1095-8649.2002.tb01854.x
https://doi.org/10.1111/j.1095-8649.2002.tb01854.x
https://doi.org/10.48045/001c.31752
https://doi.org/10.48045/001c.31752
https://doi.org/10.7717/peerj.3273
https://doi.org/10.7717/peerj.3273
https://doi.org/10.1016/j.ecoenv.2023.115609
https://doi.org/10.1016/j.aquaculture.2005.02.032
https://doi.org/10.1016/j.aquaculture.2005.02.032
https://doi.org/10.1007/s10695-006-9105-6
https://doi.org/10.1016/0300-9629(81)90287-5
https://doi.org/10.1007/s10695-019-0609-2
https://doi.org/10.1007/s10695-019-0609-2
https://doi.org/10.1631/jzus.2007.B0906
https://doi.org/10.3389/fmicb.2022.846336

	Seasonal comparison of uniform pre-slaughter fasting practices on stress response in rainbow trout (Oncorhynchus mykiss)
	1 Introduction
	2 Material and methods
	2.1 Experimental design
	2.2 Sampling
	2.3 Assay procedures
	2.3.1 Plasma analysis
	2.3.2 Liver glycogen
	2.3.3 Liver and skin color
	2.3.4 Liver gene expression

	2.4 Statistical analysis

	3 Results
	3.1 Weight and blood/plasma parameters
	3.2 Skin color
	3.3 Liver color and glycogen
	3.4 Acetylcholinesterase activity
	3.5 Liver gene expression
	3.6 Correlation analysis

	4 Discussion
	4.1 Fish growth
	4.2 Blood parameters
	4.3 Skin color
	4.4 Liver color and glycogen
	4.5 Liver gene expression

	5 Conclusions
	CRediT authorship contribution statement
	Declaration of competing interest
	Data availability
	Acknowledgements
	References